Commande rapide

Humain ALK-4 / ACVR1B transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, C-Myc Marqueur

    Fiche techniqueCommentairesProduits apparentésProtocoles
    Humain ACVR1B Informations sur les produits clonés de cDNA
    Gene_bank_ref_id:NM_004302.3
    Taille du ADNc:1518bp
    Description du ADNc:Full length Clone DNA of Homo sapiens activin A receptor, type I B, transcript variant 1 with C terminal Myc tag.
    Synonyme du gène:ALK4, SKR2, ACTRIB, ACVRLK4
    Espèces:Human
    Vecteur:pCMV3-C-Myc
    Plasmid:
    Site de restriction:
    Séquence du marqueur:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
    Description de la séquence:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with ACVR1B qPCR primers for gene expression analysis, HP100587 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Stockage:The lyophilized plasmid can be stored at room temperature for three months.
    Myc Tag Info

    A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

    A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

    The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

    Humain ALK-4 / ACVR1B transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, C-Myc Marqueur on other vectors
    Humain ALK-4 / ACVR1B transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, C-GFPSpark MarqueurHG10583-ACGCHF290
    Humain ALK-4 / ACVR1B transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, C-OFPSpark MarqueurHG10583-ACRCHF290
    Humain ALK-4 / ACVR1B transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, C-Flag MarqueurHG10583-CFCHF260
    Humain ALK-4 / ACVR1B transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, C-His MarqueurHG10583-CHCHF260
    Humain ALK-4 / ACVR1B transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, C-Myc MarqueurHG10583-CMCHF260
    Humain ALK-4 / ACVR1B transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, C-HA MarqueurHG10583-CYCHF260
    Humain ALK-4 / ACVR1B transcript variant 1 Gène ADNc clone le vecteur de clonageHG10583-MCHF90
    Humain ALK-4 / ACVR1B transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, C-Flag MarqueurHG10583-M-FCHF260
    Humain ALK-4 / ACVR1B transcript variant 1 expression plasmide de Gène l'ADNc ORF cloneHG10583-M-NCHF260
    Humain ALK-4 / ACVR1B transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, N-Flag MarqueurHG10583-NFCHF260
    Humain ALK-4 / ACVR1B transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, N-His MarqueurHG10583-NHCHF260
    Humain ALK-4 / ACVR1B transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, N-Myc MarqueurHG10583-NMCHF260
    Humain ALK-4 / ACVR1B transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, N-HA MarqueurHG10583-NYCHF260
    Humain ALK-4 / ACVR1B transcript variant 1 expression plasmide de Gène l'ADNc ORF cloneHG10583-UTCHF260
     En savoir plus sur les vecteurs d'expression
    Product nameProduct name
    Fond

    ALK-4 (Activin Receptor-Like Kinase 4) or ACVR1B (Activin A Receptor, type 1B), belongs to the protein kinase superfamily, TKL Ser/Thr protein kinase family, and TGFB receptor subfamily. ALK-4/ACVR1B acts as a transducer of activin or activin like ligands signals. Activin binds to either ACVR2A or ACVR2B and then forms a complex with ACVR1B. The known type II activin receptors include ActRII and ActRIIB, while the main type I activin receptor in mammalian cells is ALK-4 (ActRIB). In the presence of activin, type II and type I receptors form complexes whereby the type II receptors activate ALK-4 through phosphorylation. The activated ALK-4, in turn, transduces signals downstream by phosphorylation of its effectors, such as Smads, to regulate gene expression and affect cellular phenotype. ALK-4/ACVR1B is an important regulator of vertebrate development, with roles in mesoderm induction, primitive streak formation, gastrulation, dorsoanterior patterning, and left-right axis determination.

    Références
  • Chen Y, et al. (2005) Developmental analysis of activin-like kinase receptor-4 (ALK4) expression in Xenopus laevis. 232(2): 393-8.
  • J. Massagu. (1998) TGF- SIGNAL TRANSDUCTION. Annual Review of Biochemistry. 67: 753-91.
  • Size / Price
    Catalogue : HG10583-CM
    Prix catalogue : 
    Prix :      (You Save: )
    Taille :
    Quantité :+-
    Disponibilité
    Ajouter au panierBulk Discount Requiry

    Datasheet & Documentation

    Contact Us
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Veuillez noter : Tous les produits sont « DESTINÉS À LA RECHERCHE UNIQUEMENT ET NE SONT PAS PRÉVUS POUR ÊTRE UTILISÉS À DES FINS DE DIAGNOSTIC OU THÉRAPEUTIQUES »