Commande rapide

Humain Alkaline Phosphatase / ALPL expression plasmide de Gène l'ADNc ORF clone, C-His Marqueur

Fiche techniqueCommentairesProduits apparentésProtocoles
Humain ALPL Informations sur les produits clonés de cDNA
Taille du ADNc:1575bp
Description du ADNc:Full length Clone DNA of Homo sapiens alkaline phosphatase, liver/bone/kidney with C terminal His tag.
Synonyme du gène:HOPS, TNAP, TNSALP, AP-TNAP, FLJ40094, FLJ93059, MGC161443, MGC167935, ALPL
Site de restriction:
Séquence du marqueur:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Description de la séquence:
( We provide with ALPL qPCR primers for gene expression analysis, HP100469 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Humain Alkaline Phosphatase / ALPL expression plasmide de Gène l'ADNc ORF clone, C-His Marqueur on other vectors
Product nameProduct name

Alkaline phosphatase (ALPL) is a hydrolase enzyme responsible for removing phosphate groups from many types of molecules, including nucleotides, proteins, and alkaloids. The process of removing the phosphate group is called dephosphorylation. As the name suggests, alkaline phosphatases are most effective in an alkaline environment. It is sometimes used synonymously as basic phosphatase. Alkaline phosphatases (APs) are ubiquitous in many species, from bacteria to human. Four genes encode AP isoenzymes in humans and rodents. Three AP genes are expressed in a tissue-specific manner (i.e., placental, embryonic, and intestinal AP isoenzymes). Expression of the fourth AP gene is nonspecific to a single tissue and is especially abundant in bone, liver, and kidney. This isoenzyme is also called tissue-nonspecific alkaline phosphatase (TNAP). The enzyme tissue non-specific alkaline phosphatase (TNAP) belongs to the ectophosphatase family. TNAP is present in large amounts in bone in which it plays a role in mineralization.

  • Brun-Heath I, et al. (2011) Differential expression of the bone and the liver tissue non-specific alkaline phosphatase isoforms in brain tissues. Cell Tissue Res. 343(3): 521-36.
  • Whyte MP, et al. (1995) Alkaline phosphatase: placental and tissue-non-specific isoenzymes hydrolyze phosphoethanolamine, inorganic pyrophosphate, and pyridoxal 5-phosphate. J Clin Invest. 95: 1440-5.
  • Whyte MP. (1994) Hypophosphatasia and the role of alkaline phosphatase in skeletal mineralization. Endocrinol Rev. 4: 439-61.
  • Weinreb M, et al. (1990) Different pattern of alkaline phosphatase, osteopontin and osteocalcin expression in developing rat bone visualized by in situ hybridization. J Bone Miner Res. 5: 831-42.
  • Size / Price
    Catalogue : HG10440-CH
    Prix catalogue : 
    Prix :      (You Save: )
    Taille :
    Quantité :+-
    Ajouter au panierBulk Discount Requiry
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.