After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Humain ANTXR1 expression plasmide de Gène l'ADNc ORF clone, N-Flag Marqueur

Fiche techniqueCommentairesProduits apparentésProtocoles
Human ANTXR1 Informations sur les produits clonés de cDNA
Taille du ADNc:1002bp
Description du ADNc:Full length Clone DNA of Homo sapiens anthrax toxin receptor 1 with N terminal Flag tag.
Synonyme du gène:ATR, TEM8, ANTXR1
Site de restriction:
Séquence du marqueur:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Description de la séquence:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Product nameProduct name

ANTXR1 contains 1 VWFA domain and belongs to the ATR family. ATR (Ataxia telangiectasia and Rad3 related) and ATM (Ataxia telangiectasia mutated) are closely related kinases that are activated by DNA damage. They are serine-threonine protein kinases and belongs to the phosphatidylinositol 3' kinase-like kinase (PIKK) family. Upon recruitment by the DNA damage binding proteins/complexes (ATRIP for ATR; MRN for ATM), ATM/ATR initiate the DNA damage checkpoint by phosphorylating a number of key proteins. ANTXR1 interacts with extracellular matrix proteins and with the actin cytoskeleton. It functions in cell attachment and migration. ANTXR1 also mediates adhesion of cells to type 1 collagen and gelatin, reorganization of the actin cytoskeleton and promotes cell spreading. It plays a role in the angiogenic response of cultured umbilical vein endothelial cells.

  • Chaudhary A, et al. (2012) TEM8/ANTXR1 blockade inhibits pathological angiogenesis and potentiates tumoricidal responses against multiple cancer types. Cancer Cell. 21 (2): 212-26.
  • Garlick KM, et al. (2012) Binding of filamentous actin to anthrax toxin receptor 1 decreases its association with protective antigen. Biochemistry. 51 (6): 1249-56.
  • St Croix B, et al. (2000) Genes expressed in human tumor endothelium. Science. 289 (5482): 1197-202.
  • Size / Price
    Catalogue : HG13367-NF
    Prix catalogue : 
    Prix :      (You Save: )
    Taille :
    Quantité :+-
    Disponibilité2-3 weeks
    Bulk Discount RequiryAjouter au panier
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.