After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Commande rapide

Text Size:AAA

Humain Annexin VI/ANXA6 expression plasmide de Gène l'ADNc ORF clone, N-HA Marqueur

Fiche techniqueCommentairesProduits apparentésProtocoles
Human ANXA6 Informations sur les produits clonés de cDNA
Taille du ADNc:2022bp
Description du ADNc:Full length Clone DNA of Homo sapiens annexin A6 with N terminal HA tag.
Synonyme du gène:ANX6; CBP68
Site de restriction:
Séquence du marqueur:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Description de la séquence:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Humain Annexin VI/ANXA6 expression plasmide de Gène l'ADNc ORF clone, N-HA Marqueur on other vectors
Humain Annexin VI/ANXA6 expression plasmide de Gène l'ADNc ORF clone, C-GFPSpark MarqueurHG11161-ACGCHF294
Humain Annexin VI/ANXA6 expression plasmide de Gène l'ADNc ORF clone, C-OFPSpark MarqueurHG11161-ACRCHF294
Humain Annexin VI/ANXA6 expression plasmide de Gène l'ADNc ORF clone, N-GFPSpark MarqueurHG11161-ANGCHF294
Humain Annexin VI/ANXA6 expression plasmide de Gène l'ADNc ORF clone, N-OFPSpark MarqueurHG11161-ANRCHF294
Humain Annexin VI/ANXA6 expression plasmide de Gène l'ADNc ORF clone, C-Flag MarqueurHG11161-CFCHF90
Humain Annexin VI/ANXA6 expression plasmide de Gène l'ADNc ORF clone, C-His MarqueurHG11161-CHCHF258
Humain Annexin VI/ANXA6 expression plasmide de Gène l'ADNc ORF clone, C-Myc MarqueurHG11161-CMCHF258
Humain Annexin VI/ANXA6 expression plasmide de Gène l'ADNc ORF clone, C-HA MarqueurHG11161-CYCHF258
Humain Annexin VI/ANXA6 expression plasmide de Gène l'ADNc ORF clone, C-Flag MarqueurHG11161-M-FCHF258
Humain Annexin VI/ANXA6 expression plasmide de Gène l'ADNc ORF clone, N-Flag MarqueurHG11161-NFCHF258
Humain Annexin VI/ANXA6 expression plasmide de Gène l'ADNc ORF clone, N-His MarqueurHG11161-NHCHF258
Humain Annexin VI/ANXA6 expression plasmide de Gène l'ADNc ORF clone, N-Myc MarqueurHG11161-NMCHF258
Humain Annexin VI/ANXA6 expression plasmide de Gène l'ADNc ORF clone, N-HA MarqueurHG11161-NYCHF258
Humain Annexin VI/ANXA6 Gène ADNc clone le vecteur de clonageHG11161-UCHF90
Humain Annexin VI/ANXA6 expression plasmide de Gène l'ADNc ORF cloneHG11161-UTCHF258
 En savoir plus sur les vecteurs d'expression
Product nameProduct name

Annexin A6, also known as ANXA6 or ANXAⅥ, belongs to a family of Ca2+-dependent membrane and phospholipid binding proteins. Members of this family have been implicated in membrane-related events along exocytotic and endocytotic pathways. Annexin 6 is phosphorylated in vivo associated with cell growth. Annexin 6 was not phosphorylated in quiescent cells, but was phosphorylated on serine and to a lesser extent threonine, several hours following cell stimulation. Experiment has revealed the presence of annexin A6 on the cell surface of variety cells as putative receptors and / or binding proteins for chondroitin sulfate proteoglycans, helping cells to bind with this extracellular matrix glycosaminoglycan chondroitin sulfate which is related to the cell-substratum adhesion. A post-tranlational modification other than direct protein phosphorylation may influence the activity of annexin6 and provide evidence linking cell growth with regulation of annexin 6 function. 

  • Takagi H, et al. (2002) Annexin 6 is a putative cell surface receptor for chondroitin sulfate chains. J Cell Sci. 115 (16): 3309-18.
  • Moss SE, et al. (1992) A growth-dependent post-translational modification of annexin VI. Biochim Biophys Acta. 1160 (1): 120-6.
  • Song G, et al. (1998) Altered cardiac annexin mRNA and protein levels in the left ventricle of patients with end-stage heart failure. J Mol Cell Cardio. 30 (3): 443-51.
  • Size / Price
    Catalogue : HG11161-NY
    Prix catalogue : 
    Prix :      (You Save: )
    Taille :
    Quantité :+-
    Disponibilité2-3 weeks
    Bulk Discount RequiryAjouter au panier
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.