Annexin VIII/ANXA8L1 cDNA ORF Clone, Human, N-Myc tag

Price:
Size:
Number:

Annexin VIII/ANXA8L1 cDNA ORF Clone, Human, N-Myc tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
831 bp
Description
Full length Clone DNA of Human annexin A8-like 1 with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

Annexin VIII/ANXA8L1 cDNA ORF Clone, Human, N-Myc tag: Alternative Names

ANXA8 cDNA ORF Clone, Human; ANXA8L2 cDNA ORF Clone, Human; bA145E20.2 cDNA ORF Clone, Human; VAC-beta cDNA ORF Clone, Human

Annexin VIII/ANXA8L1 Background Information

Full Name
annexin A8-like 1
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait