After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Commande rapide

Text Size:AAA

Human AP2M1 natural ORF mammalian expression plasmid

Fiche techniqueCommentairesProduits apparentésProtocoles
Human AP2M1 Informations sur les produits clonés de cDNA
Gene_bank_ref_id:BC004996.1
Taille du ADNc:1308bp
Description du ADNc:Full length Clone DNA of Homo sapiens adaptor-related protein complex 2, mu 1 subunit.
Synonyme du gène:mu2, AP50, CLAPM1
Espèces:Human
Vecteur:pCMV3-untagged
Plasmid:pCMV3-AP2M1
Site de restriction:HindIII + NotI (6.1kb + 1.31kb)
Séquence du marqueur:
Description de la séquence:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
Size / Price
Catalogue : HG16144-UT
Prix catalogue :   (Save )
Prix :      [How to order]
DisponibilitéIn Stock Instructions d’expédition
Images
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Veuillez noter : Tous les produits sont « DESTINÉS À LA RECHERCHE UNIQUEMENT ET NE SONT PAS PRÉVUS POUR ÊTRE UTILISÉS À DES FINS DE DIAGNOSTIC OU THÉRAPEUTIQUES »