Commande rapide

Text Size:AAA

Humain Aprataxin/APTX expression plasmide de Gène l'ADNc ORF clone, C-His Marqueur

    Fiche techniqueCommentairesProduits apparentésProtocoles
    Humain APTX Informations sur les produits clonés de cDNA
    Gene_bank_ref_id:NM_175071.1
    Taille du ADNc:507bp
    Description du ADNc:Full length Clone DNA of Homo sapiens aprataxin with C terminal His tag.
    Synonyme du gène:AOA, AOA1, AXA1, EAOH, EOAHA, FHA-HIT, MGC1072, FLJ20157, APTX
    Espèces:Human
    Vecteur:pCMV3-C-His
    Plasmid:
    Site de restriction:
    Séquence du marqueur:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
    Description de la séquence:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with APTX qPCR primers for gene expression analysis, HP100483 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Stockage:The lyophilized plasmid can be stored at room temperature for three months.
    His Tag Info

    A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

    Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

    Humain Aprataxin/APTX expression plasmide de Gène l'ADNc ORF clone, C-His Marqueur on other vectors
    Humain Aprataxin/APTX expression plasmide de Gène l'ADNc ORF clone, C-GFPSpark MarqueurHG10454-ACGCHF270
    Humain Aprataxin/APTX expression plasmide de Gène l'ADNc ORF clone, C-OFPSpark MarqueurHG10454-ACRCHF270
    Humain Aprataxin/APTX expression plasmide de Gène l'ADNc ORF clone, N-GFPSpark MarqueurHG10454-ANGCHF270
    Humain Aprataxin/APTX expression plasmide de Gène l'ADNc ORF clone, N-OFPSpark MarqueurHG10454-ANRCHF270
    Humain Aprataxin/APTX expression plasmide de Gène l'ADNc ORF clone, C-Flag MarqueurHG10454-CFCHF230
    Humain Aprataxin/APTX expression plasmide de Gène l'ADNc ORF clone, C-His MarqueurHG10454-CHCHF230
    Humain Aprataxin/APTX expression plasmide de Gène l'ADNc ORF clone, C-Myc MarqueurHG10454-CMCHF230
    Humain Aprataxin/APTX expression plasmide de Gène l'ADNc ORF clone, C-HA MarqueurHG10454-CYCHF230
    Humain Aprataxin/APTX Gène ADNc clone le vecteur de clonageHG10454-MCHF90
    Humain Aprataxin/APTX expression plasmide de Gène l'ADNc ORF clone, C-Flag MarqueurHG10454-M-FCHF230
    Humain Aprataxin/APTX expression plasmide de Gène l'ADNc ORF clone, N-Flag MarqueurHG10454-NFCHF230
    Humain Aprataxin/APTX expression plasmide de Gène l'ADNc ORF clone, N-His MarqueurHG10454-NHCHF230
    Humain Aprataxin/APTX expression plasmide de Gène l'ADNc ORF clone, N-Myc MarqueurHG10454-NMCHF230
    Humain Aprataxin/APTX expression plasmide de Gène l'ADNc ORF clone, N-HA MarqueurHG10454-NYCHF230
    Humain Aprataxin/APTX expression plasmide de Gène l'ADNc ORF cloneHG10454-UTCHF230
     En savoir plus sur les vecteurs d'expression
    Product nameProduct name
    Size / Price
    Catalogue : HG10454-CH
    Prix catalogue : 
    Prix :      (You Save: )
    Taille :
    Quantité :+-
    Disponibilité
    Ajouter au panierBulk Discount Requiry

    Datasheet & Documentation

    Contact Us
      Articles consultés récemment
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Veuillez noter : Tous les produits sont « DESTINÉS À LA RECHERCHE UNIQUEMENT ET NE SONT PAS PRÉVUS POUR ÊTRE UTILISÉS À DES FINS DE DIAGNOSTIC OU THÉRAPEUTIQUES »