After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Commande rapide

Text Size:AAA

Humain Aprataxin/APTX expression plasmide de Gène l'ADNc ORF clone, C-His Marqueur

Fiche techniqueCommentairesProduits apparentésProtocoles
Human APTX Informations sur les produits clonés de cDNA
Taille du ADNc:507bp
Description du ADNc:Full length Clone DNA of Homo sapiens aprataxin with C terminal His tag.
Synonyme du gène:AOA, AOA1, AXA1, EAOH, EOAHA, FHA-HIT, MGC1072, FLJ20157, APTX
Site de restriction:
Séquence du marqueur:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Description de la séquence:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Humain Aprataxin/APTX expression plasmide de Gène l'ADNc ORF clone, C-His Marqueur on other vectors
Humain Aprataxin/APTX expression plasmide de Gène l'ADNc ORF clone, C-GFPSpark MarqueurHG10454-ACGCHF270
Humain Aprataxin/APTX expression plasmide de Gène l'ADNc ORF clone, C-OFPSpark MarqueurHG10454-ACRCHF270
Humain Aprataxin/APTX expression plasmide de Gène l'ADNc ORF clone, N-GFPSpark MarqueurHG10454-ANGCHF270
Humain Aprataxin/APTX expression plasmide de Gène l'ADNc ORF clone, N-OFPSpark MarqueurHG10454-ANRCHF270
Humain Aprataxin/APTX expression plasmide de Gène l'ADNc ORF clone, C-Flag MarqueurHG10454-CFCHF230
Humain Aprataxin/APTX expression plasmide de Gène l'ADNc ORF clone, C-His MarqueurHG10454-CHCHF230
Humain Aprataxin/APTX expression plasmide de Gène l'ADNc ORF clone, C-Myc MarqueurHG10454-CMCHF230
Humain Aprataxin/APTX expression plasmide de Gène l'ADNc ORF clone, C-HA MarqueurHG10454-CYCHF230
Humain Aprataxin/APTX Gène ADNc clone le vecteur de clonageHG10454-MCHF90
Humain Aprataxin/APTX expression plasmide de Gène l'ADNc ORF clone, C-Flag MarqueurHG10454-M-FCHF230
Humain Aprataxin/APTX expression plasmide de Gène l'ADNc ORF clone, N-Flag MarqueurHG10454-NFCHF230
Humain Aprataxin/APTX expression plasmide de Gène l'ADNc ORF clone, N-His MarqueurHG10454-NHCHF230
Humain Aprataxin/APTX expression plasmide de Gène l'ADNc ORF clone, N-Myc MarqueurHG10454-NMCHF230
Humain Aprataxin/APTX expression plasmide de Gène l'ADNc ORF clone, N-HA MarqueurHG10454-NYCHF230
Humain Aprataxin/APTX expression plasmide de Gène l'ADNc ORF cloneHG10454-UTCHF230
 En savoir plus sur les vecteurs d'expression
Product nameProduct name
Size / Price
Catalogue : HG10454-CH
Prix catalogue : 
Prix :      (You Save: )
Taille :
Quantité :+-
Disponibilité2-3 weeks
Bulk Discount RequiryAjouter au panier
Contact Us
      Articles consultés récemment
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.