Aquaporin 1 cDNA ORF Clone, Human, N-Myc tag

Price:
Size:
Number:

Aquaporin 1 cDNA ORF Clone, Human, N-Myc tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
810 bp
Description
Full length Clone DNA of Human aquaporin 1 (Colton blood group) with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

Aquaporin 1 cDNA ORF Clone, Human, N-Myc tag: Alternative Names

AQP-CHIP cDNA ORF Clone, Human; CHIP28 cDNA ORF Clone, Human; CO cDNA ORF Clone, Human

Aquaporin 1 Background Information

Aquaporins (AQPs) are a family of hydrophobic integral membrane proteins that function as transmembrane channels and play an important role in tissue homeostasis. Aquaporin-1 (AQP1), in particular, has been reported to be involved in several biological processes including inflammation, angiogenesis, wound healing and others. Aquaporin-1 (AQP1) is expressed in the heart and it has been reported to transport nitric oxide (NO), an important regulator of cardiac function. AQP1 may be a useful diagnosis and prognosis marker for osteosarcoma. AQP1 knockdown can effectively inhibit cell proliferation, adhesion, invasion and tumorigenesis by targeting TGF-beta signaling pathway and focal adhesion genes, which may serve a promising therapeutic strategy for osteosarcoma. AQP1 plays an important role in gastric adenocarcinoma and may therefore represent a novel therapeutic target and prognostic marker in this disease. Malignant pleural mesothelioma (MPM) is an aggressive cancer. MPM cells express aquaporin-1 (AQP1) that in other cancers has been shown to participate in the tumor metastasis processes. AQP1 is expressed in atherosclerotic lesion neovasculature in human and mouse arteries and AQP1 deficiency augments lesion development in ANGII-promoted atherosclerosis in mice. Normal function of AQP1 affords cardiovascular protection. AQP1 effectively downregulated AQP1 expression at the mRNA and protein levels, markedly suppressed cell viability, migration and invasion and promoted apoptosis of ovarian cancers cells. These results suggested that AQP1 may serve as a novel target for ovarian cancer treatment in the future.
Full Name
aquaporin 1 (Colton blood group)
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait