ARL2BP cDNA ORF Clone, Human, N-HA tag

Price:
Size:
Number:

ARL2BP cDNA ORF Clone, Human, N-HA tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
492 bp
Description
Full length Clone DNA of Human ADP-ribosylation factor-like 2 binding protein with N terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

ARL2BP cDNA ORF Clone, Human, N-HA tag: Alternative Names

BART cDNA ORF Clone, Human; BART1 cDNA ORF Clone, Human; RP66 cDNA ORF Clone, Human

ARL2BP Background Information

ADP-ribosylation factor (ARF)-like proteins (ARLs) comprise a functionally distinct group of the ARF family of RAS-related GTPases. ARL2BP binds to ARL2.GTP with high affinity but does not interact with ARL2.GDP, activated ARF, or RHO proteins. The lack of detectable membrane association of ARL2BP or ARL2 upon activation of ARL2 is suggestive of actions distinct from those of the ARFs. ARL2BP is considered to be the first ARL2-specific effector identified, due to its interaction with ARL2.GTP but lack of ARL2 GTPase-activating protein activity. ARL2BP, together with ARL2, plays a role in the nuclear translocation, retention and transcriptional activity of STAT3. ARL2BP may play a role as an effector of ARL2.
Full Name
ADP-ribosylation factor-like 2 binding protein
References
  • Qiu J. et al., 2011, PLoS Pathog. 7 (8): e1002193.
  • Taniuchi K. et al., 2012, PLoS One. 7 (4): e35674.
  • Taniuchi K. et al., 2012, Neoplasia. 14 (5): 440-50.

ARL2BP cDNA ORF Clone, Rat, Related Products

Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait