Commande rapide

Humain beta Arrestin 1/ARRB1 expression plasmide de Gène l'ADNc ORF clone, N-His Marqueur

    Fiche techniqueCommentairesProduits apparentésProtocoles
    Humain ARRB1 Informations sur les produits clonés de cDNA
    Gene_bank_ref_id:BC003636
    Taille du ADNc:1257bp
    Description du ADNc:Full length Clone DNA of Homo sapiens arrestin, beta 1 with N terminal His tag.
    Synonyme du gène:ARB1, ARR1, ARRB1
    Espèces:Human
    Vecteur:pCMV3-N-His
    Plasmid:
    Site de restriction:
    Séquence du marqueur:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
    Description de la séquence:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with ARRB1 qPCR primers for gene expression analysis, HP101914 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Stockage:The lyophilized plasmid can be stored at room temperature for three months.
    His Tag Info

    A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

    Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

    Humain beta Arrestin 1/ARRB1 expression plasmide de Gène l'ADNc ORF clone, N-His Marqueur on other vectors
    Humain beta Arrestin 1/ARRB1 expression plasmide de Gène l'ADNc ORF clone, C-GFPSpark MarqueurHG12310-ACGCHF270
    Humain beta Arrestin 1/ARRB1 expression plasmide de Gène l'ADNc ORF clone, C-OFPSpark MarqueurHG12310-ACRCHF270
    Humain beta Arrestin 1/ARRB1 expression plasmide de Gène l'ADNc ORF clone, N-GFPSpark MarqueurHG12310-ANGCHF270
    Humain beta Arrestin 1/ARRB1 expression plasmide de Gène l'ADNc ORF clone, N-OFPSpark MarqueurHG12310-ANRCHF270
    Humain beta Arrestin 1/ARRB1 expression plasmide de Gène l'ADNc ORF clone, C-Flag MarqueurHG12310-CFCHF230
    Humain beta Arrestin 1/ARRB1 expression plasmide de Gène l'ADNc ORF clone, C-His MarqueurHG12310-CHCHF230
    Humain beta Arrestin 1/ARRB1 expression plasmide de Gène l'ADNc ORF clone, C-Myc MarqueurHG12310-CMCHF230
    Humain beta Arrestin 1/ARRB1 expression plasmide de Gène l'ADNc ORF clone, C-HA MarqueurHG12310-CYCHF230
    Humain beta Arrestin 1/ARRB1 Gène ADNc clone le vecteur de clonageHG12310-GCHF90
    Humain beta Arrestin 1/ARRB1 expression plasmide de Gène l'ADNc ORF clone, N-Flag MarqueurHG12310-NFCHF230
    Humain beta Arrestin 1/ARRB1 expression plasmide de Gène l'ADNc ORF clone, N-His MarqueurHG12310-NHCHF230
    Humain beta Arrestin 1/ARRB1 expression plasmide de Gène l'ADNc ORF clone, N-Myc MarqueurHG12310-NMCHF230
    Humain beta Arrestin 1/ARRB1 expression plasmide de Gène l'ADNc ORF clone, N-HA MarqueurHG12310-NYCHF230
    Humain beta Arrestin 1/ARRB1 expression plasmide de Gène l'ADNc ORF cloneHG12310-UTCHF230
     En savoir plus sur les vecteurs d'expression
    Product nameProduct name
    Size / Price
    Catalogue : HG12310-NH
    Prix catalogue : 
    Prix :      (You Save: )
    Taille :
    Quantité :+-
    Disponibilité
    Ajouter au panierBulk Discount Requiry

    Datasheet & Documentation

    Contact Us
      Articles consultés récemment
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Veuillez noter : Tous les produits sont « DESTINÉS À LA RECHERCHE UNIQUEMENT ET NE SONT PAS PRÉVUS POUR ÊTRE UTILISÉS À DES FINS DE DIAGNOSTIC OU THÉRAPEUTIQUES »