Commande rapide

Humain Arylsulfatase A / ARSA expression plasmide de Gène l'ADNc ORF clone, C-His Marqueur

Fiche techniqueCommentairesProduits apparentésProtocoles
Human ARSA Informations sur les produits clonés de cDNA
Taille du ADNc:1524bp
Description du ADNc:Full length Clone DNA of Homo sapiens arylsulfatase A with C terminal His tag.
Synonyme du gène:MLD, ARSA
Site de restriction:
Séquence du marqueur:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Description de la séquence:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Humain Arylsulfatase A / ARSA expression plasmide de Gène l'ADNc ORF clone, C-His Marqueur on other vectors
Humain Arylsulfatase A / ARSA expression plasmide de Gène l'ADNc ORF clone, C-GFPSpark MarqueurHG10449-ACGCHF290
Humain Arylsulfatase A / ARSA expression plasmide de Gène l'ADNc ORF clone, C-OFPSpark MarqueurHG10449-ACRCHF290
Humain Arylsulfatase A / ARSA expression plasmide de Gène l'ADNc ORF clone, C-Flag MarqueurHG10449-CFCHF260
Humain Arylsulfatase A / ARSA expression plasmide de Gène l'ADNc ORF clone, C-His MarqueurHG10449-CHCHF260
Humain Arylsulfatase A / ARSA expression plasmide de Gène l'ADNc ORF clone, C-Myc MarqueurHG10449-CMCHF260
Humain Arylsulfatase A / ARSA expression plasmide de Gène l'ADNc ORF clone, C-HA MarqueurHG10449-CYCHF260
Humain Arylsulfatase A / ARSA Gène ADNc clone le vecteur de clonageHG10449-MCHF90
Humain Arylsulfatase A / ARSA expression plasmide de Gène l'ADNc ORF clone, C-Flag MarqueurHG10449-M-FCHF260
Humain Arylsulfatase A / ARSA expression plasmide de Gène l'ADNc ORF cloneHG10449-M-NCHF260
Humain Arylsulfatase A / ARSA expression plasmide de Gène l'ADNc ORF clone, N-Flag MarqueurHG10449-NFCHF260
Humain Arylsulfatase A / ARSA expression plasmide de Gène l'ADNc ORF clone, N-His MarqueurHG10449-NHCHF260
Humain Arylsulfatase A / ARSA expression plasmide de Gène l'ADNc ORF clone, N-Myc MarqueurHG10449-NMCHF260
Humain Arylsulfatase A / ARSA expression plasmide de Gène l'ADNc ORF clone, N-HA MarqueurHG10449-NYCHF260
Humain Arylsulfatase A / ARSA expression plasmide de Gène l'ADNc ORF cloneHG10449-UTCHF260
 En savoir plus sur les vecteurs d'expression
Product nameProduct name

Arylsulfatase A (ARSA) is synthesized as a 52KDa lysosomal enzyme. It is a member of the sulfatase family that is required for the lysosomal degradation of cerebroside-3-sulfate, a sphingolipid sulfate ester and a major constituent of the myelin sheet. Arylsulfatase A is activated by a required co- or posttranslational modification with the oxidation of cysteine to formylglycine. Metachromatic leukodystrophy (MLD) is a lysosomal storage disease in the central and peripheral nervous systems with severe and progressive neurological symptoms caused by the deficiency of Arylsulfatase A. Deficiency of this enzyme is also found in apparently healthy individuals, a condition for which the term pseudodeficiency is introduced. ARSA forms dimers after receiving three N-linked oligosaccharides in the endoplasmic reticulum, and then the dimers are transported to the Golgi where they receive mannose 6-phosphate recognition markers. And thus, ARSA is transported and delivered to dense lysosomes in a mannose 6-phosphate receptor-dependent manner. It has been shown that within the lysosomes, the ARSA dimers can oligomerize to an octamer in a pH-dependent manner. The ARSA deficiency leads to metachromatic leucodystrophy (MLD), a lysosomal storage disorder associated with severe and progressive demyelination in he central and peripheral nervous system. Additionally, the serum level of arylsulfatase A might be helpful in diagnosis of lung and central nervous system cancer.

  • Laidler PM. (1991) Arylsulfatase A--physico-chemical properties and the use of enzyme radioimmunoassay in medical diagnosis Folia Med Cracov. 32(3-4): 149-68.
  • Jean S, et al. (2006) Ethanol decreases rat hepatic arylsulfatase A activity levels. Alcohol Clin Exp Res. 30(11): 1950-5.
  • Size / Price
    Catalogue : HG10449-CH
    Prix catalogue : 
    Prix :      (You Save: )
    Taille :
    Quantité :+-
    Disponibilité2-3 weeks
    Bulk Discount RequiryAjouter au panier
    Contact Us
        Articles consultés récemment
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.