Commande rapide

Human ARSB ORF mammalian expression plasmid, N-His tag

Fiche techniqueRéférences spécifiquesCommentairesProduits apparentésProtocoles
ARSBInformations sur les produits clonés de cDNA
Taille du ADNc:1602bp
Description du ADNc:Full length Clone DNA of Homo sapiens arylsulfatase B with N terminal His tag.
Synonyme du gène:ASB, G4S, MPS6, ARSB
Site de restriction:
Séquence du marqueur:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Description de la séquence:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
Other ARSB Protein Products
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Related Products
Product nameProduct name
Size / Price
Catalogue :HG13674-NH
Prix catalogue : CHF280.00  (Save CHF0.00)
Prix :CHF280.00      [How to order]
N2-3 weeks