Commande rapide

Humain ASPH/Aspartate beta hydroxylase expression plasmide de Gène l'ADNc ORF clone, C-His Marqueur

    Fiche techniqueCommentairesProduits apparentésProtocoles
    Humain ASPH Informations sur les produits clonés de cDNA
    Gene_bank_ref_id:BC066929
    Taille du ADNc:612bp
    Description du ADNc:Full length Clone DNA of Homo sapiens aspartate beta-hydroxylase with C terminal His tag.
    Synonyme du gène:AAH, BAH, HAAH, JCTN, junctin, CASQ2BP1
    Espèces:Human
    Vecteur:pCMV3-C-His
    Plasmid:
    Site de restriction:
    Séquence du marqueur:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
    Description de la séquence:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with ASPH qPCR primers for gene expression analysis, HP103780 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Stockage:The lyophilized plasmid can be stored at room temperature for three months.
    His Tag Info

    A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

    Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

    Humain ASPH/Aspartate beta hydroxylase expression plasmide de Gène l'ADNc ORF clone, C-His Marqueur on other vectors
    Humain ASPH/Aspartate beta hydroxylase expression plasmide de Gène l'ADNc ORF clone, C-GFPSpark MarqueurHG15153-ACGCHF270
    Humain ASPH/Aspartate beta hydroxylase expression plasmide de Gène l'ADNc ORF clone, C-OFPSpark MarqueurHG15153-ACRCHF270
    Humain ASPH/Aspartate beta hydroxylase expression plasmide de Gène l'ADNc ORF clone, N-GFPSpark MarqueurHG15153-ANGCHF270
    Humain ASPH/Aspartate beta hydroxylase expression plasmide de Gène l'ADNc ORF clone, N-OFPSpark MarqueurHG15153-ANRCHF270
    Humain ASPH/Aspartate beta hydroxylase expression plasmide de Gène l'ADNc ORF clone, C-Flag MarqueurHG15153-CFCHF230
    Humain ASPH/Aspartate beta hydroxylase expression plasmide de Gène l'ADNc ORF clone, C-His MarqueurHG15153-CHCHF230
    Humain ASPH/Aspartate beta hydroxylase expression plasmide de Gène l'ADNc ORF clone, C-Myc MarqueurHG15153-CMCHF230
    Humain ASPH/Aspartate beta hydroxylase expression plasmide de Gène l'ADNc ORF clone, C-HA MarqueurHG15153-CYCHF230
    Humain ASPH/Aspartate beta hydroxylase Gène ADNc clone le vecteur de clonageHG15153-GCHF90
    Humain ASPH/Aspartate beta hydroxylase expression plasmide de Gène l'ADNc ORF clone, N-Flag MarqueurHG15153-NFCHF230
    Humain ASPH/Aspartate beta hydroxylase expression plasmide de Gène l'ADNc ORF clone, N-His MarqueurHG15153-NHCHF230
    Humain ASPH/Aspartate beta hydroxylase expression plasmide de Gène l'ADNc ORF clone, N-Myc MarqueurHG15153-NMCHF230
    Humain ASPH/Aspartate beta hydroxylase expression plasmide de Gène l'ADNc ORF clone, N-HA MarqueurHG15153-NYCHF230
    Humain ASPH/Aspartate beta hydroxylase expression plasmide de Gène l'ADNc ORF cloneHG15153-UTCHF230
     En savoir plus sur les vecteurs d'expression
    Product nameProduct name
    Size / Price
    Catalogue : HG15153-CH
    Prix catalogue : 
    Prix :      (You Save: )
    Taille :
    Quantité :+-
    Disponibilité
    Ajouter au panierBulk Discount Requiry

    Datasheet & Documentation

    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Veuillez noter : Tous les produits sont « DESTINÉS À LA RECHERCHE UNIQUEMENT ET NE SONT PAS PRÉVUS POUR ÊTRE UTILISÉS À DES FINS DE DIAGNOSTIC OU THÉRAPEUTIQUES »