After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Commande rapide

Text Size:AAA

Humain ATP1B1 expression plasmide de Gène l'ADNc ORF clone

Fiche techniqueCommentairesProduits apparentésProtocoles
Human ATP1B1 Informations sur les produits clonés de cDNA
Gene_bank_ref_id:BC000006
Taille du ADNc:912bp
Description du ADNc:Full length Clone DNA of Homo sapiens ATPase, NA+/K+ transporting, beta 1 polypeptide.
Synonyme du gène:ATP1B, MGC1798, ATP1B1
Espèces:Human
Vecteur:pCMV3-untagged
Plasmid:
Site de restriction:
Séquence du marqueur:
Description de la séquence:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
Fond

ATP1B1 belongs to the family of Na+/K+ and H+/K+-ATPases beta chain proteins, and to the subfamily of Na+/K+ -ATPases. ATP1B1 is a subunit of Na+/K+-ATPase. Na+/K+-ATPase is an integral membrane protein responsible for establishing and maintaining the electrochemical gradients of Na and K ions across the plasma membrane. Na+/K+-ATPase is composed of two subunits, a large catalytic subunit (alpha) and a smaller glycoprotein subunit (beta). ATP1B1 regulates, through assembly of alpha/beta heterodimers, the number of sodium pumps transported to the plasma membrane. ATP1B1 is the non-catalytic component of the active enzyme, which catalyzes the hydrolysis of ATP coupled with which catalyzes the hydrolysis of ATP coupled with the exchange of Na+ and K+ ions across the plasma membrane.

Références
  • Lingrel JB. et al., 1990, Prog Nucleic Acid Res Mol Biol. 38: 37-89.
  • Oakey RJ. et al., 1993, Hum Mol Genet. 1 (8): 613-20.
  • Ushkaryov YuA. et al., 1990, FEBS Lett. 257 (2): 439-42.
  • Size / Price
    Catalogue : HG14255-UT
    Prix catalogue : 
    Prix :      (You Save: )
    Taille :
    Quantité :+-
    Disponibilité2-3 weeks
    Bulk Discount RequiryAjouter au panier
    Contact Us
    Images
        Articles consultés récemment
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Veuillez noter : Tous les produits sont « DESTINÉS À LA RECHERCHE UNIQUEMENT ET NE SONT PAS PRÉVUS POUR ÊTRE UTILISÉS À DES FINS DE DIAGNOSTIC OU THÉRAPEUTIQUES »