Commande rapide

Humain ATPase Inhibitory Factor 1 expression plasmide de Gène l'ADNc ORF clone, C-His Marqueur

    Fiche techniqueCommentairesProduits apparentésProtocoles
    Humain ATPIF1 Informations sur les produits clonés de cDNA
    Gene_bank_ref_id:BC009677
    Taille du ADNc:321bp
    Description du ADNc:Full length Clone DNA of Homo sapiens ATPase inhibitory factor 1 with C terminal His tag.
    Synonyme du gène:IP, ATPI, ATPIP, ATPIF1
    Espèces:Human
    Vecteur:pCMV3-C-His
    Plasmid:
    Site de restriction:
    Séquence du marqueur:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
    Description de la séquence:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with ATPIF1 qPCR primers for gene expression analysis, HP102653 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Stockage:The lyophilized plasmid can be stored at room temperature for three months.
    His Tag Info

    A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

    Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

    Humain ATPase Inhibitory Factor 1 expression plasmide de Gène l'ADNc ORF clone, C-His Marqueur on other vectors
    Humain ATPase Inhibitory Factor 1 expression plasmide de Gène l'ADNc ORF clone, C-GFPSpark MarqueurHG13997-ACGCHF270
    Humain ATPase Inhibitory Factor 1 expression plasmide de Gène l'ADNc ORF clone, C-OFPSpark MarqueurHG13997-ACRCHF270
    Humain ATPase Inhibitory Factor 1 expression plasmide de Gène l'ADNc ORF clone, N-GFPSpark MarqueurHG13997-ANGCHF270
    Humain ATPase Inhibitory Factor 1 expression plasmide de Gène l'ADNc ORF clone, N-OFPSpark MarqueurHG13997-ANRCHF270
    Humain ATPase Inhibitory Factor 1 expression plasmide de Gène l'ADNc ORF clone, C-Flag MarqueurHG13997-CFCHF230
    Humain ATPase Inhibitory Factor 1 expression plasmide de Gène l'ADNc ORF clone, C-His MarqueurHG13997-CHCHF230
    Humain ATPase Inhibitory Factor 1 expression plasmide de Gène l'ADNc ORF clone, C-Myc MarqueurHG13997-CMCHF230
    Humain ATPase Inhibitory Factor 1 expression plasmide de Gène l'ADNc ORF clone, C-HA MarqueurHG13997-CYCHF230
    Humain ATPase Inhibitory Factor 1 Gène ADNc clone le vecteur de clonageHG13997-GCHF90
    Humain ATPase Inhibitory Factor 1 expression plasmide de Gène l'ADNc ORF clone, N-Flag MarqueurHG13997-NFCHF230
    Humain ATPase Inhibitory Factor 1 expression plasmide de Gène l'ADNc ORF clone, N-His MarqueurHG13997-NHCHF230
    Humain ATPase Inhibitory Factor 1 expression plasmide de Gène l'ADNc ORF clone, N-Myc MarqueurHG13997-NMCHF230
    Humain ATPase Inhibitory Factor 1 expression plasmide de Gène l'ADNc ORF clone, N-HA MarqueurHG13997-NYCHF230
    Humain ATPase Inhibitory Factor 1 expression plasmide de Gène l'ADNc ORF cloneHG13997-UTCHF230
     En savoir plus sur les vecteurs d'expression
    Product nameProduct name
    Size / Price
    Catalogue : HG13997-CH
    Prix catalogue : 
    Prix :      (You Save: )
    Taille :
    Quantité :+-
    Disponibilité
    Ajouter au panierBulk Discount Requiry

    Datasheet & Documentation

    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Veuillez noter : Tous les produits sont « DESTINÉS À LA RECHERCHE UNIQUEMENT ET NE SONT PAS PRÉVUS POUR ÊTRE UTILISÉS À DES FINS DE DIAGNOSTIC OU THÉRAPEUTIQUES »