ATPase Inhibitory Factor 1 cDNA ORF Clone, Human, N-His tag

Price:
Size:
Number:

ATPase Inhibitory Factor 1 cDNA ORF Clone, Human, N-His tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
321 bp
Description
Full length Clone DNA of Human ATPase inhibitory factor 1 with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

ATPase Inhibitory Factor 1 cDNA ORF Clone, Human, N-His tag: Alternative Names

ATPI cDNA ORF Clone, Human; ATPIF1 cDNA ORF Clone, Human; ATPIP cDNA ORF Clone, Human; IP cDNA ORF Clone, Human

ATPase Inhibitory Factor 1 Background Information

Heme oxygenase-1 (HO-1) and ATPase inhibitory factor (ATPIF) 1 is often overexpressed in different types of cancer cells. To gain a physiological significance, we treated the synthetic flavonoids in colon cancer cells, HT29 and HCT116 cells and confirmed that overexpression of both HO-1 and ATPIF1 was critical for tumor cell death with an impaired mitochondrial energetics. It would provide a strategy for developing selective anti-tumor candidates. A transgene-based model of a heteroplasmic lethal mtDNA deletion (mtDNAΔ) in adult Drosophila muscle. Stimulation of autophagy, activation of the PINK1/parkin pathway or decreased levels of mitofusin result in a selective decrease in mtDNAΔ. Decreased levels of mitofusin and increased levels of ATPIF1, an inhibitor of ATP synthase reversal-dependent mitochondrial repolarization, result in a further decrease in mtDNAΔ levels. The loss of ATPIF1 strongly protects against antimycin-induced ETC dysfunction and cell death by allowing for the maintenance of mitochondrial membrane potential. Inhibition of ATPIF1 ameliorates complex III blockade in primary hepatocytes, a cell type afflicted in severe mitochondrial disease, that inhibition of ATPIF1 can ameliorate severe ETC dysfunction in mitochondrial pathology.
Full Name
ATPase inhibitory factor 1
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait