After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Humain Aurora A/AURKA expression plasmide de Gène l'ADNc ORF clone

Fiche techniqueCommentairesProduits apparentésProtocoles
Human AURKA Informations sur les produits clonés de cDNA
Gene_bank_ref_id:NM_198433.1
Taille du ADNc:1212bp
Description du ADNc:Full length Clone DNA of Homo sapiens aurora kinase A.
Synonyme du gène:AIK, ARK1, AURA, BTAK, STK6, STK7, STK15, AURORA2, MGC34538, AURKA
Espèces:Human
Vecteur:pCMV3-untagged
Plasmid:pCMV3-AURKA
Site de restriction:KpnI + XbaI (6.1kb + 1.21kb)
Séquence du marqueur:
Description de la séquence:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
Human AURKA Gene Plasmid Map
Human AURKA Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
Humain Aurora A/AURKA expression plasmide de Gène l'ADNc ORF clone on other vectors
Humain Aurora A/AURKA expression plasmide de Gène l'ADNc ORF clone, C-GFPSpark MarqueurHG10669-ACGCHF270
Humain Aurora A/AURKA expression plasmide de Gène l'ADNc ORF clone, C-OFPSpark MarqueurHG10669-ACRCHF270
Humain Aurora A/AURKA expression plasmide de Gène l'ADNc ORF clone, N-GFPSpark MarqueurHG10669-ANGCHF270
Humain Aurora A/AURKA expression plasmide de Gène l'ADNc ORF clone, N-OFPSpark MarqueurHG10669-ANRCHF270
Humain Aurora A/AURKA expression plasmide de Gène l'ADNc ORF clone, C-Flag MarqueurHG10669-CFCHF230
Humain Aurora A/AURKA expression plasmide de Gène l'ADNc ORF clone, C-His MarqueurHG10669-CHCHF230
Humain Aurora A/AURKA expression plasmide de Gène l'ADNc ORF clone, C-Myc MarqueurHG10669-CMCHF230
Humain Aurora A/AURKA expression plasmide de Gène l'ADNc ORF clone, C-HA MarqueurHG10669-CYCHF230
Humain Aurora A/AURKA Gène ADNc clone le vecteur de clonageHG10669-MCHF90
Humain Aurora A/AURKA expression plasmide de Gène l'ADNc ORF clone, C-Flag MarqueurHG10669-M-FCHF230
Humain Aurora A/AURKA expression plasmide de Gène l'ADNc ORF clone, N-Flag MarqueurHG10669-NFCHF230
Humain Aurora A/AURKA expression plasmide de Gène l'ADNc ORF clone, N-His MarqueurHG10669-NHCHF230
Humain Aurora A/AURKA expression plasmide de Gène l'ADNc ORF clone, N-Myc MarqueurHG10669-NMCHF230
Humain Aurora A/AURKA expression plasmide de Gène l'ADNc ORF clone, N-HA MarqueurHG10669-NYCHF230
Humain Aurora A/AURKA expression plasmide de Gène l'ADNc ORF cloneHG10669-UTCHF230
 En savoir plus sur les vecteurs d'expression
Product nameProduct name
Size / Price
Catalogue : HG10669-UT
Prix catalogue : 
Prix :      (You Save: )
Taille :
Quantité :+-
DisponibilitéIn Stock
Bulk Discount RequiryAjouter au panier
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
Veuillez noter : Tous les produits sont « DESTINÉS À LA RECHERCHE UNIQUEMENT ET NE SONT PAS PRÉVUS POUR ÊTRE UTILISÉS À DES FINS DE DIAGNOSTIC OU THÉRAPEUTIQUES »