Angiogenin cDNA ORF Clone, Human, C-His tag

Cat: HG10441-CH

Contact us:

215-583-7898
order_us@sinobiological.com
Distributors

All Angiogenin Reagents

CRO Services

Product recommended


All Angiogenin Reagents

Angiogenin cDNA ORF Clone, Human, C-His tag General Information

Gene

Species
Human
NCBI Ref Seq
RefSeq ORF Size
489 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human angiogenin, ribonuclease, RNase A family, 5 with C terminal His tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Restriction Sites
KpnI + XbaI(6kb+0.49kb)
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

Angiogenin cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Angiogenin cDNA ORF Clone, Human, C-His tag Validated Images

other Green fluorescent protein / GFP Gene Plasmid Map 5610

Angiogenin cDNA ORF Clone, Human, C-His tag Alternative Names

ALS9 cDNA ORF Clone, Human;HEL168 cDNA ORF Clone, Human;RAA1 cDNA ORF Clone, Human;RNASE4 cDNA ORF Clone, Human;RNASE5 cDNA ORF Clone, Human

Angiogenin Background Information

Angiogenin is a protein crucial in angiogenesis, and it is overexpressed in many cancers and downregulated in neurodegenerative diseases, respectively. The protein interaction with actin, through the loop encompassing the 6-68 residues, is an essential step in the cellular cytoskeleton reorganization. This, in turn, influences the cell proliferation and migration processes. Angiogenin (ANG) is a secretory ribonuclease that promotes the proliferation of endothelial cells, leading to angiogenesis. This function relies on its ribonucleolytic activity, which is low for simple RNA substrates. Upon entry into the cytosol, ANG is sequestered by the ribonuclease inhibitor protein (RNH1). ANG is a potent cytotoxin for RNH1-knockout HeLa cells, belying its inefficiency as a nonspecific catalyst. The toxicity does, however, rely on the ribonucleolytic activity of ANG and a cytosolic localization, which lead to the accumulation of particular tRNA fragments (tRFs), such as tRF-5 Gly-GCC. These up-regulated tRFs are highly cytotoxic at physiological concentrations. Although ANG is well-known for its promotion of cell growth. Angiogenin and osteoprotegerin are triceps specific myokines with beta-cell protective actions against proinflammatory cytokines. Angiogenin and EPCs are modulated by rehabilitation after cerebral ischemia, suggesting that both angiogenin and EPCs could serve as biomarkers of improvement during rehabilitation or future therapeutic targets.
Full Name
angiogenin, ribonuclease, RNase A family, 5

Angiogenin cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
Angiogenin cDNA ORF Clone in Cloning Vector, Mouse MG58280-U
Angiogenin cDNA ORF Clone, Mouse, untagged MG58280-UT
Angiogenin cDNA ORF Clone, Mouse, C-GFPSpark® tag MG58280-ACG
Angiogenin Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG58280-ACGLN
Angiogenin cDNA ORF Clone, Mouse, C-OFPSpark® tag MG58280-ACR
Angiogenin cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG58280-CF
Angiogenin cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG58280-NF
Angiogenin cDNA ORF Clone, Mouse, C-His tag MG58280-CH
Angiogenin cDNA ORF Clone, Mouse, N-His tag MG58280-NH
Angiogenin cDNA ORF Clone, Mouse, C-HA tag MG58280-CY
Angiogenin cDNA ORF Clone, Mouse, N-HA tag MG58280-NY
Angiogenin cDNA ORF Clone, Mouse, C-Myc tag MG58280-CM
Angiogenin cDNA ORF Clone, Mouse, N-Myc tag MG58280-NM

Angiogenin cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
Angiogenin cDNA ORF Clone in Cloning Vector, Human HG10441-M
Angiogenin cDNA ORF Clone, Human, untagged HG10441-UT
Angiogenin cDNA ORF Clone, Human, C-GFPSpark® tag HG10441-ACG
Angiogenin Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10441-ACGLN
Angiogenin cDNA ORF Clone, Human, C-OFPSpark® tag HG10441-ACR
Angiogenin cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10441-CF
Angiogenin cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10441-NF
Angiogenin cDNA ORF Clone, Human, N-His tag HG10441-NH
Angiogenin cDNA ORF Clone, Human, C-HA tag HG10441-CY
Angiogenin cDNA ORF Clone, Human, N-HA tag HG10441-NY
Angiogenin cDNA ORF Clone, Human, C-Myc tag HG10441-CM
Angiogenin cDNA ORF Clone, Human, N-Myc tag HG10441-NM
Angiogenin qPCR Primer Pairs, Human HP100470
info info
添加购物车成功! 添加购物车失败!