Angiopoietin-4 cDNA ORF Clone, Human, untagged

1/1
Price:
Size:
Number:

Angiopoietin-4 cDNA ORF Clone, Human, untagged: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1512 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence except for the point mutations: 12 G>A not causing the amino acid variation.
Description
Full length Clone DNA of Human angiopoietin 4.
Plasmid
Promoter
Enhanced CMV promoter
Restriction Sites
KpnI + XbaI (6.1kb + 1.51kb)
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

Angiopoietin-4 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Angiopoietin-4 cDNA ORF Clone, Human, untagged: Validated Images

Angiopoietin-4 cDNA ORF Clone, Human, untagged: Alternative Names

AGP4 cDNA ORF Clone, Human; ANG-3 cDNA ORF Clone, Human; ANG4 cDNA ORF Clone, Human

Angiopoietin-4 Background Information

Full Name
angiopoietin 4
References
  • Grosios K, et al. (1999) Assignment of ANGPT4, ANGPT1, and ANGPT2 encoding angiopoietins 4, 1 and 2 to human chromosome bands 20p13, 8q22.3?q23 and 8p23.1, respectively, by in situ hybridization and radiation hybrid mapping. Cytogenet. Cell Genet. 84 (1-2): 118-20.
  • Yamakawa M, et al. (2004) Expression of angiopoietins in renal epithelial and clear cell carcinoma cells: regulation by hypoxia and participation in angiogenesis. Am J Physiol Renal Physiol. 287 (4): 649-57.
  • Oliner J, et al. (2004) Suppression of angiogenesis and tumor growth by selective inhibition of angiopoietin-2. Cancer Cell. 6 (5): 507-16.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait