Commande rapide

Humain ANGPTL4 / angiopoietin-like Protéine 4 transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, N-Flag Marqueur

    Fiche techniqueCommentairesProduits apparentésProtocoles
    Humain ANGPTL4 Informations sur les produits clonés de cDNA
    Gene_bank_ref_id:NM_139314.1
    Taille du ADNc:1221bp
    Description du ADNc:Full length Clone DNA of Homo sapiens angiopoietin-like 4, transcript variant 1 with N terminal Flag tag.
    Synonyme du gène:NL2, ARP4, FIAF, PGAR, HFARP, pp1158, ANGPTL2
    Espèces:Human
    Vecteur:pCMV3-SP-N-FLAG
    Plasmid:
    Site de restriction:
    Séquence du marqueur:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
    Description de la séquence:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with ANGPTL4 qPCR primers for gene expression analysis, HP100574 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Stockage:The lyophilized plasmid can be stored at room temperature for three months.
    FLAG Tag Info

    FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

    A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

    The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

    Humain ANGPTL4 / angiopoietin-like Protéine 4 transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, N-Flag Marqueur on other vectors
    Humain ANGPTL4 / angiopoietin-like Protéine 4 transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, C-GFPSpark MarqueurHG10563-ACGCHF270
    Humain ANGPTL4 / angiopoietin-like Protéine 4 transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, C-OFPSpark MarqueurHG10563-ACRCHF270
    Humain ANGPTL4 / angiopoietin-like Protéine 4 transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, C-Flag MarqueurHG10563-CFCHF230
    Humain ANGPTL4 / angiopoietin-like Protéine 4 transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, C-His MarqueurHG10563-CHCHF230
    Humain ANGPTL4 / angiopoietin-like Protéine 4 transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, C-Myc MarqueurHG10563-CMCHF230
    Humain ANGPTL4 / angiopoietin-like Protéine 4 transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, C-HA MarqueurHG10563-CYCHF230
    Humain ANGPTL4 / angiopoietin-like Protéine 4 transcript variant 1 Gène ADNc clone le vecteur de clonageHG10563-MCHF90
    Humain ANGPTL4 / angiopoietin-like Protéine 4 transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, C-Flag MarqueurHG10563-M-FCHF230
    Humain ANGPTL4 / angiopoietin-like Protéine 4 transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, N-Flag MarqueurHG10563-NFCHF230
    Humain ANGPTL4 / angiopoietin-like Protéine 4 transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, N-His MarqueurHG10563-NHCHF230
    Humain ANGPTL4 / angiopoietin-like Protéine 4 transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, N-Myc MarqueurHG10563-NMCHF230
    Humain ANGPTL4 / angiopoietin-like Protéine 4 transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, N-HA MarqueurHG10563-NYCHF230
    Humain ANGPTL4 / angiopoietin-like Protéine 4 transcript variant 1 expression plasmide de Gène l'ADNc ORF cloneHG10563-UTCHF230
     En savoir plus sur les vecteurs d'expression
    Product nameProduct name
    Fond

    ANGPTL4, also known as ANGPTL2, is a protein with hypoxia-induced expression in endothelial cells. It contains 1 fibrinogen C-terminal domain and is expressed at high levels in the placenta, heart, liver, muscle, pancreas and lung but expressed poorly in the brain and kidney. ANGPTL4 inhibits proliferation, migration, and tubule formation of endothelial cells and reduces vascular leakage. It may act as a regulator of angiogenesis and modulate tumorigenesis. It inhibits proliferation, migration, and tubule formation of endothelial cells and reduces vascular leakage. It may also exert a protective function on endothelial cells through an endocrine action. ANGPTL4 is directly involved in regulating glucose homeostasis, lipid metabolism, and insulin sensitivity. In response to hypoxia, the unprocessed form of the protein accumulates in the subendothelial extracellular matrix (ECM). The matrix-associated and immobilized unprocessed form limits the formation of actin stress fibers and focal contacts in the adhering endothelial cells and inhibits their adhesion. It also decreases motility of endothelial cells and inhibits the sprouting and tube formation.

    Références
  • Lichtenstein L, et al. (2010) Angptl4 Protects against Severe Proinflammatory Effects of Saturated Fat by Inhibiting Fatty Acid Uptake into Mesenteric Lymph Node Macrophages. Cell metabolism. 12(6): 580-92.
  • Terada S, et al. (2011) Escaping Anoikis through ROS: ANGPTL4 controls integrin signaling through Nox1. Cancer Cell. 19(3):297-9.
  • Zhu PC, et al. (2011) Angptl4 protein elevates the prosurvival intracellular O2(-):H2O2 ratio and confers anoikis resistance to tumors. Cancer Cell. 19(3):401-15.
  • Size / Price
    Catalogue : HG10563-NF
    Prix catalogue : 
    Prix :      (You Save: )
    Taille :
    Quantité :+-
    Disponibilité
    Ajouter au panierBulk Discount Requiry

    Datasheet & Documentation

    Contact Us
      Articles consultés récemment
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Veuillez noter : Tous les produits sont « DESTINÉS À LA RECHERCHE UNIQUEMENT ET NE SONT PAS PRÉVUS POUR ÊTRE UTILISÉS À DES FINS DE DIAGNOSTIC OU THÉRAPEUTIQUES »