B3GAT3 cDNA ORF Clone, Human, C-DDK (Flag®) tag

Price:
Size:
Number:

B3GAT3 cDNA ORF Clone, Human, C-DDK (Flag®) tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1008 bp
Description
Full length Clone DNA of Human beta-1,3-glucuronyltransferase 3 (glucuronosyltran with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

B3GAT3 cDNA ORF Clone, Human, C-DDK (Flag®) tag: Alternative Names

GLCATI cDNA ORF Clone, Human; glcUAT-I cDNA ORF Clone, Human

B3GAT3 Background Information

B3GAT3, encoding beta-1,3-glucuronyltransferase 3, has an important role in proteoglycan biosynthesis. Homozygous B3GAT3 mutations have been associated with short stature, skeletal deformities, and congenital heart defects. There is a novel B3GAT3-related disorder with craniosynostosis and bone fragility, due to a unique homozygous mutation in B3GAT3.
Full Name
beta-1,3-glucuronyltransferase 3
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait