BCAT2/BCATM cDNA ORF Clone, Human, N-HA tag

Price:
Size:
Number:

BCAT2/BCATM cDNA ORF Clone, Human, N-HA tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1179 bp
Description
Full length Clone DNA of Human branched chain aminotransferase 2, mitochondrial, nuclear gene encoding mitochondrial protein with N terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

BCAT2/BCATM cDNA ORF Clone, Human, N-HA tag: Alternative Names

BCAM cDNA ORF Clone, Human; BCATM cDNA ORF Clone, Human; BCT2 cDNA ORF Clone, Human; PP18 cDNA ORF Clone, Human
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait