After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Commande rapide

Text Size:AAA

Humain BCL2L1/Bcl-XL expression plasmide de Gène l'ADNc ORF clone, C-His Marqueur

Fiche techniqueCommentairesProduits apparentésProtocoles
Human BCL2L1 Informations sur les produits clonés de cDNA
Gene_bank_ref_id:NM_138578.1
Taille du ADNc:702bp
Description du ADNc:Full length Clone DNA of Homo sapiens BCL2-like 1 with C terminal His tag.
Synonyme du gène:BCLX, BCL2L, Bcl-X, bcl-xL, bcl-xS, BCL-XL/S, DKFZp781P2092, BCL2L1
Espèces:Human
Vecteur:pCMV3-C-His
Plasmid:
Site de restriction:
Séquence du marqueur:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Description de la séquence:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Humain BCL2L1/Bcl-XL expression plasmide de Gène l'ADNc ORF clone, C-His Marqueur on other vectors
Product nameProduct name
Fond

B-cell lymphoma-extra large (Bcl-xl) is a transmembrane molecule in the mitochondria. Bcl-xL (BCL2L1) , belongs to the Bcl-2 family. Members of the bcl-2 family encode proteins that function either to promote or to inhibit apoptosis. Antiapoptotic members such as Bcl-2 and Bcl-xL prevent PCD in response to a wide variety of stimuli to take part in cancer survival. Conversely, proapoptotic proteins, exemplified by Bax and Bak, can accelerate death and in some instances are sufficient to cause apoptosis independent of additional signals. The crystal and solution structures of a Bcl-2 family member, Bcl-xL is like this: The structures consist of two central, primarily hydrophobic α-helices, which are surrounded by amphipathic helices. A 60-residue loop connecting helices αl and α2 was found to be flexible and non-essential for anti-apoptotic activity. Bcl-xL is chareacterized as important factors in autophagy, inhibiting Beclin 1-mediated autophagy by binding to Beclin 1. In addition, Beclin 1, Bcl-2 and Bcl-xL can cooperate with Atg5 or Ca2+ to regulate both autophagy and apoptosis. Bcl-xL is also implicated in anoxia induced cell death. The pathway is initiated by the loss of function of the prosurvival Bcl-2 family members Mcl-1 and Bcl-2 / Bcl-XL, resulting in Bax- or Bak-dependent release of cytochrome c and subsequent caspase-9-dependent cell death. Thus, Bcl-xL, the well-characterized apoptosis guards, appears to be important in cell death.

Références
  • Vander Heiden MG, et al. (1997) Bcl-xL Regulates the Membrane Potential and Volume Homeostasis of Mitochondria. Cell. 91 (5): 627-37.
  • Muchmore SW, et al. (1996) X-ray and NMR structure of human Bcl-xL, an inhibitor of programmed cell death. Nature. 381: 335-341.
  • SharoffEH, et al. (2007) Bcl-2 family members regulate anoxia-induced cell death. Antioxid Redox Signal. 9 (9) :1405-9.
  • Zhou F, et al. (2011) Bcl-2 and Bcl-xL play important roles in the crosstalk between autophagy and apoptosis. FEBS J. 278 (3): 403-13.
  • Size / Price
    Catalogue : HG10455-CH
    Prix catalogue : 
    Prix :      (You Save: )
    Taille :
    Quantité :+-
    Disponibilité2-3 weeks
    Bulk Discount RequiryAjouter au panier
    Contact Us
    Images
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Veuillez noter : Tous les produits sont « DESTINÉS À LA RECHERCHE UNIQUEMENT ET NE SONT PAS PRÉVUS POUR ÊTRE UTILISÉS À DES FINS DE DIAGNOSTIC OU THÉRAPEUTIQUES »