Commande rapide

Text Size:AAA

Humain Survivin/BIRC5/API4 transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, C-Flag Marqueur

Fiche techniqueCommentairesProduits apparentésProtocoles
Human BIRC5 Informations sur les produits clonés de cDNA
Taille du ADNc:429bp
Description du ADNc:Full length Clone DNA of Homo sapiens baculoviral IAP repeat-containing 5, transcript variant 1 with C terminal Flag tag.
Synonyme du gène:API4, EPR-1
Site de restriction:KpnI + XbaI (6kb + 0.47kb)
Séquence du marqueur:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Description de la séquence:Identical with the Gene Bank Ref. ID sequence.
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
Human BIRC5 Gene Plasmid Map
Human BIRC5 transcript variant 1 natural ORF mammalian expression plasmid, C-Flag tag
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Humain Survivin/BIRC5/API4 transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, C-Flag Marqueur on other vectors
Humain Survivin/BIRC5/API4 transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, C-GFPSpark MarqueurHG10356-ACGCHF270
Humain Survivin/BIRC5/API4 transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, C-OFPSpark MarqueurHG10356-ACRCHF270
Humain Survivin/BIRC5/API4 transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, N-GFPSpark MarqueurHG10356-ANGCHF270
Humain Survivin/BIRC5/API4 transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, N-OFPSpark MarqueurHG10356-ANRCHF270
Humain Survivin/BIRC5/API4 transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, C-Flag MarqueurHG10356-CFCHF230
Humain Survivin/BIRC5/API4 transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, C-His MarqueurHG10356-CHCHF230
Humain Survivin/BIRC5/API4 transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, C-Myc MarqueurHG10356-CMCHF230
Humain Survivin/BIRC5/API4 transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, C-HA MarqueurHG10356-CYCHF230
Humain Survivin/BIRC5/API4 transcript variant 1 Gène ADNc clone le vecteur de clonageHG10356-MCHF90
Humain Survivin/BIRC5/API4 transcript variant 1 expression plasmide de Gène l'ADNc ORF cloneHG10356-M-NCHF230
Humain Survivin/BIRC5/API4 transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, N-Flag MarqueurHG10356-NFCHF230
Humain Survivin/BIRC5/API4 transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, N-His MarqueurHG10356-NHCHF230
Humain Survivin/BIRC5/API4 transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, N-Myc MarqueurHG10356-NMCHF230
Humain Survivin/BIRC5/API4 transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, N-HA MarqueurHG10356-NYCHF230
Humain Survivin/BIRC5/API4 transcript variant 1 expression plasmide de Gène l'ADNc ORF cloneHG10356-UTCHF230
 En savoir plus sur les vecteurs d'expression
Product nameProduct name

BIRC5, also known as Survivin and EPR-1, is a member of the IAP family. IAP family members usually contain multiple baculovirus IAP repeat (BIR) domains, but BIRC5 has only a single BIR domain. It is expressed cell cycle-dependently and highly expressed at mitosis. As a multitasking protein, BIRC5 has dual roles in promoting cell proliferation and preventing apoptosis. Survivin is a component of a chromosome passage protein complex (CPC) which is essential for chromosome alignment and segregation during mitosis and cytokinesis. Survivin acts as an important regulator of the localization of this complex. It may counteract a default induction of apoptosis in G2/M phase.

  • Altieri DC. 1994, J Biol Chem. 269 (5): 3139-42.
  • Bouchard BA. et al., 2002, Thromb Haemost. 86 (4): 1133-5.
  • Yao XQ. et al., 2004, World J Gastroenterol. 10 (9): 1262-7.
  • Size / Price
    Catalogue : HG10356-CF
    Prix catalogue : 
    Prix :      (You Save: )
    Taille :
    Quantité :+-
    DisponibilitéIn Stock
    Bulk Discount RequiryAjouter au panier
    Contact Us
    • Human BIRC5 transcript variant 1 natural ORF mammalian expression plasmid, C-Flag tag
    • Human FetuinA / AHSG ORF mammalian expression plasmid, C-Flag tag
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.