Commande rapide

Humain BMX transcript variant 2 expression plasmide de Gène l'ADNc ORF clone, N-His Marqueur

Fiche techniqueCommentairesProduits apparentésProtocoles
Human BMX Informations sur les produits clonés de cDNA
Taille du ADNc:2028bp
Description du ADNc:Full length Clone DNA of Homo sapiens BMX non-receptor tyrosine kinase transcript variant 2 with N terminal His tag.
Synonyme du gène:ETK, PSCTK2, PSCTK3, BMX
Site de restriction:
Séquence du marqueur:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Description de la séquence:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Humain BMX transcript variant 2 expression plasmide de Gène l'ADNc ORF clone, N-His Marqueur on other vectors
Humain BMX transcript variant 2 expression plasmide de Gène l'ADNc ORF clone, C-GFPSpark MarqueurHG11394-ACGCHF290
Humain BMX transcript variant 2 expression plasmide de Gène l'ADNc ORF clone, C-OFPSpark MarqueurHG11394-ACRCHF290
Humain BMX transcript variant 2 expression plasmide de Gène l'ADNc ORF clone, N-GFPSpark MarqueurHG11394-ANGCHF290
Humain BMX transcript variant 2 expression plasmide de Gène l'ADNc ORF clone, N-OFPSpark MarqueurHG11394-ANRCHF290
Humain BMX transcript variant 2 expression plasmide de Gène l'ADNc ORF clone, C-Flag MarqueurHG11394-CFCHF260
Humain BMX transcript variant 2 expression plasmide de Gène l'ADNc ORF clone, C-His MarqueurHG11394-CHCHF260
Humain BMX transcript variant 2 expression plasmide de Gène l'ADNc ORF clone, C-Myc MarqueurHG11394-CMCHF260
Humain BMX transcript variant 2 expression plasmide de Gène l'ADNc ORF clone, C-HA MarqueurHG11394-CYCHF260
Humain BMX transcript variant 2 Gène ADNc clone le vecteur de clonageHG11394-MCHF90
Humain BMX transcript variant 2 expression plasmide de Gène l'ADNc ORF clone, C-Flag MarqueurHG11394-M-FCHF260
Humain BMX transcript variant 2 expression plasmide de Gène l'ADNc ORF clone, N-Flag MarqueurHG11394-NFCHF260
Humain BMX transcript variant 2 expression plasmide de Gène l'ADNc ORF clone, N-His MarqueurHG11394-NHCHF260
Humain BMX transcript variant 2 expression plasmide de Gène l'ADNc ORF clone, N-Myc MarqueurHG11394-NMCHF260
Humain BMX transcript variant 2 expression plasmide de Gène l'ADNc ORF clone, N-HA MarqueurHG11394-NYCHF260
Humain BMX transcript variant 2 expression plasmide de Gène l'ADNc ORF cloneHG11394-UTCHF260
 En savoir plus sur les vecteurs d'expression
Product nameProduct name
Size / Price
Catalogue : HG11394-NH
Prix catalogue : 
Prix :      (You Save: )
Taille :
Quantité :+-
Disponibilité2-3 weeks
Bulk Discount RequiryAjouter au panier
Contact Us
      Articles consultés récemment
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.