Commande rapide

Humain BPHL expression plasmide de Gène l'ADNc ORF clone, C-His Marqueur

    Fiche techniqueCommentairesProduits apparentésProtocoles
    Humain BPHL Informations sur les produits clonés de cDNA
    Gene_bank_ref_id:BC106901
    Taille du ADNc:825bp
    Description du ADNc:Full length Clone DNA of Homo sapiens biphenyl hydrolase-like (serine hydrolase) with C terminal His tag.
    Synonyme du gène:MCNAA, BPH-RP, VACVASE
    Espèces:Human
    Vecteur:pCMV3-C-His
    Plasmid:
    Site de restriction:
    Séquence du marqueur:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
    Description de la séquence:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with BPHL qPCR primers for gene expression analysis, HP102354 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Stockage:The lyophilized plasmid can be stored at room temperature for three months.
    His Tag Info

    A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

    Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

    Product nameProduct name
    Fond

    BPHL is a member of the serine protease family. BPHL is expressed large quantities in liver and kidney and in minor quantities in heart, intestine and skeletal muscle. BPHL is a specific alpha-amino acid ester hydrolase that prefers small, hydrophobic, and aromatic side chains and does not have a stringent requirement for the leaving group other than preferring a primary alcohol. It catalyzes the hydrolytic activation of amino acid ester prodrugs of nucleoside analogs such as valacyclovir and valganciclovir. BPHL also activates valacyclovir to acyclovir. It may play a role in detoxification processes.

    Références
  • Lai L. et al., 2008, J Biol Chem. 283 (14): 9318-27.
  • Davila S. et al., 2010, Genes Immun. 11 (3): 232-8.
  • Hendrickson SL. et al., 2010, PLoS One. 5 (9): e12862.
  • Size / Price
    Catalogue : HG15763-CH
    Prix catalogue : 
    Prix :      (You Save: )
    Taille :
    Quantité :+-
    Disponibilité
    Ajouter au panierBulk Discount Requiry

    Datasheet & Documentation

    Contact Us
      Articles consultés récemment
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Veuillez noter : Tous les produits sont « DESTINÉS À LA RECHERCHE UNIQUEMENT ET NE SONT PAS PRÉVUS POUR ÊTRE UTILISÉS À DES FINS DE DIAGNOSTIC OU THÉRAPEUTIQUES »