C7orf27 cDNA ORF Clone, Human, C-DDK (Flag®) tag

Price:
Size:
Number:

C7orf27 cDNA ORF Clone, Human, C-DDK (Flag®) tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
2466 bp
Description
Full length Clone DNA of Human chromosome 7 open reading frame 27 with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

More Information About C7orf27

Entrez Gene ID

C7orf27 cDNA ORF Clone, Human, C-DDK (Flag®) tag: Alternative Names

BAAT1 cDNA ORF Clone, Human; C7orf27 cDNA ORF Clone, Human; RMFSL cDNA ORF Clone, Human

C7orf27 Background Information

C7orf27 cDNA ORF Clone, Human, Related Products

Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait