BTN2A2 cDNA ORF Clone, Human, C-His tag

Price:
Size:
Number:

BTN2A2 cDNA ORF Clone, Human, C-His tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1011 bp
Description
Full length Clone DNA of Human butyrophilin, subfamily 2, member A2 with C terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

BTN2A2 cDNA ORF Clone, Human, C-His tag: Alternative Names

BT2.2 cDNA ORF Clone, Human; BTF2 cDNA ORF Clone, Human; BTN2.2 cDNA ORF Clone, Human

BTN2A2 Background Information

The human and mouse genes encoding butyrophilin-2A2 (BTN2A2) are regulated by the class II trans-activator and regulatory factor X, two transcription factors dedicated to major histocompatibility complex class II expression, suggesting a role in T cell immunity. To address this, Btn2a2-deficient mice are generated. Btn2a2−/− mice exhibited enhanced effector CD4+ and CD8+ T cell responses, impaired CD4+ regulatory T cell induction, potentiated antitumor responses, and exacerbated experimental autoimmune encephalomyelitis. Altered immune responses were attributed to Btn2a2 deficiency in antigen-presenting cells rather than T cells or nonhematopoietic cells. These results provide the first genetic evidence that BTN2A2 is a co-inhibitory molecule that modulates T cell–mediated immunity.
Full Name
butyrophilin, subfamily 2, member A2
References
  • Sarter K, Leimgruber E, Gobet F, et al. Btn2a2, a T cell immunomodulatory molecule coregulated with MHC class II genes. The Journal of Experimental Medicine. 2016;213(2):177-187.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait