Biglycan cDNA ORF Clone, Human, N-His tag

1/1
Price:
Size:
Number:

Biglycan cDNA ORF Clone, Human, N-His tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1107 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence except for the point mutations: 576C/T not causing the amino acid variation.
Description
Full length Clone DNA of Human biglycan with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Restriction Sites
KpnI + XbaI (6kb + 1.14kb)
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

Biglycan cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Biglycan cDNA ORF Clone, Human, N-His tag: Validated Images

Biglycan cDNA ORF Clone, Human, N-His tag: Alternative Names

DSPG1 cDNA ORF Clone, Human; PG-S1 cDNA ORF Clone, Human; PGI cDNA ORF Clone, Human; SLRR1A cDNA ORF Clone, Human

Biglycan Background Information

Biglycan, also known as PG-S1 and BGN, is a a small leucine-rich repeat proteoglycan (SLRP). It can be detected in a variety of extracellular matrix tissues, including bone, cartilage and tendon. Biglycan consists of a protein core containing leucine-rich repeat regions and two glycosaminoglycan (GAG) chains consisting of either chondroitin sulfate (CS) or dermatan sulfate (DS). Non-glycanated forms of biglycan (no GAG chains) increase with age in human articular cartilage. Biglycan interacts with collagen, both via the core protein and GAG chains. Biglycan plays a role in the mineralisation of bone. Biglycan core protein binds to the growth factors BMP-4 and influences its bioactivity.
Full Name
biglycan
References
  • Fisher L.W., et al.,(1989), Deduced protein sequence of bone small proteoglycan I (biglycan) shows homology with proteoglycan II (decorin) and several nonconnective tissue proteins in a variety of species. J. Biol. Chem. 264:4571-4576.
  • Fisher L.W., et al., (1991), Human biglycan gene. Putative promoter, intron-exon junctions, and chromosomal localization.J. Biol. Chem. 266:14371-14377.
  • Mallon A.-M., et al.,(2000), Comparative genome sequence analysis of the Bpa/Str region in mouse and man.Genome Res. 10:758-775.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait