After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Commande rapide

Text Size:AAA

Humain Bruton Tyrosine Kinase / BTK Kinase expression plasmide de Gène l'ADNc ORF clone, C-Myc Marqueur

Fiche techniqueCommentairesProduits apparentésProtocoles
Human BTK Informations sur les produits clonés de cDNA
Gene_bank_ref_id:NM_000061.2
Taille du ADNc:1980bp
Description du ADNc:Full length Clone DNA of Homo sapiens Bruton agammaglobulinemia tyrosine kinase with C terminal Myc tag.
Synonyme du gène:AT, ATK, BPK, XLA, IMD1, AGMX1, PSCTK1, MGC126261, MGC126262
Espèces:Human
Vecteur:pCMV3-C-Myc
Plasmid:pCMV3-BTK-Myc
Site de restriction:KpnI + NotI (6kb + 2.03kb)
Séquence du marqueur:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Description de la séquence:Identical with the Gene Bank Ref. ID sequence except for the point mutations: 1899C/T not causing the amino acid variation.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
Human BTK Gene Plasmid Map
Human Bruton Tyrosine Kinase / BTK Kinase ORF mammalian expression plasmid, C-Myc tag
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Humain Bruton Tyrosine Kinase / BTK Kinase expression plasmide de Gène l'ADNc ORF clone, C-Myc Marqueur on other vectors
Humain Bruton Tyrosine Kinase / BTK Kinase expression plasmide de Gène l'ADNc ORF clone, C-GFPSpark MarqueurHG10578-ACGCHF290
Humain Bruton Tyrosine Kinase / BTK Kinase expression plasmide de Gène l'ADNc ORF clone, C-OFPSpark MarqueurHG10578-ACRCHF290
Humain Bruton Tyrosine Kinase / BTK Kinase expression plasmide de Gène l'ADNc ORF clone, N-GFPSpark MarqueurHG10578-ANGCHF290
Humain Bruton Tyrosine Kinase / BTK Kinase expression plasmide de Gène l'ADNc ORF clone, N-OFPSpark MarqueurHG10578-ANRCHF290
Humain Bruton Tyrosine Kinase / BTK Kinase expression plasmide de Gène l'ADNc ORF clone, C-Flag MarqueurHG10578-CFCHF260
Humain Bruton Tyrosine Kinase / BTK Kinase expression plasmide de Gène l'ADNc ORF clone, C-His MarqueurHG10578-CHCHF260
Humain Bruton Tyrosine Kinase / BTK Kinase expression plasmide de Gène l'ADNc ORF clone, C-Myc MarqueurHG10578-CMCHF260
Humain Bruton Tyrosine Kinase / BTK Kinase expression plasmide de Gène l'ADNc ORF clone, C-HA MarqueurHG10578-CYCHF260
Humain Bruton Tyrosine Kinase / BTK Kinase Gène ADNc clone le vecteur de clonageHG10578-MCHF90
Humain Bruton Tyrosine Kinase / BTK Kinase expression plasmide de Gène l'ADNc ORF clone, N-Flag MarqueurHG10578-NFCHF260
Humain Bruton Tyrosine Kinase / BTK Kinase expression plasmide de Gène l'ADNc ORF clone, N-His MarqueurHG10578-NHCHF260
Humain Bruton Tyrosine Kinase / BTK Kinase expression plasmide de Gène l'ADNc ORF clone, N-Myc MarqueurHG10578-NMCHF260
Humain Bruton Tyrosine Kinase / BTK Kinase expression plasmide de Gène l'ADNc ORF clone, N-HA MarqueurHG10578-NYCHF260
Humain Bruton Tyrosine Kinase / BTK Kinase expression plasmide de Gène l'ADNc ORF cloneHG10578-UTCHF260
 En savoir plus sur les vecteurs d'expression
Product nameProduct name
Fond

Bruton's tyrosine kinase (or BTK) is a type of kinase protein expressed in B lymphocytes and T cells. BTK contains a PH domain which binds phosphatidylinositol(3,4,5)-trisphosphate (PIP3). After binding to PIP3, BTK is induced to phosphorylate phospholipase C, which in turn hydrolyzes PIP2 into two second messagers, IP3 and DAG, which then modulate the activity of downstream proteins during B-cell signaling. Btk is also found implicated in the primary immunodeficiency disease X-linked agammaglobulinemia(Bruton's agammaglobulinemia). BTK played a key role in B-cell maturation as well as mast cell activation through the high-affinity IgE receptor. Patients with X-linked agammaglobulinemia have normal pre-B cell populations in their bone marrow but these B-cells can not mature and enter the circulation.

Références
  • Hashimoto S, et al. (1996) Identification of Bruton's tyrosine kinase (Btk) gene mutations and characterization of the derived proteins in 35 X-linked agammaglobulinemia families: a nationwide study of Btk deficiency in Japan. Blood. 88(2): 561-73.
  • Ohta Y, et al. (1994) Genomic organization and structure of Bruton agammaglobulinemia tyrosine kinase: localization of mutations associated with varied clinical presentations and course in X chromosome-linked agammaglobulinemia. PNAS. 91(19): 9062-6.
  • Smith C, et al. (1994) Expression of Bruton's agammaglobulinemia tyrosine kinase gene, BTK, is selectively down-regulated in T lymphocytes and plasma cells. The Journal of Immunology. 152(2): 557-65.
  • Size / Price
    Catalogue : HG10578-CM
    Prix catalogue : 
    Prix :      (You Save: )
    Taille :
    Quantité :+-
    DisponibilitéIn Stock
    Bulk Discount RequiryAjouter au panier
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Veuillez noter : Tous les produits sont « DESTINÉS À LA RECHERCHE UNIQUEMENT ET NE SONT PAS PRÉVUS POUR ÊTRE UTILISÉS À DES FINS DE DIAGNOSTIC OU THÉRAPEUTIQUES »