Commande rapide

Text Size:AAA

Human C5 Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
C5cDNA Clone Product Information
Gene Bank Ref.ID:NM_001735.2
cDNA Size:5031
cDNA Description:ORF Clone of Homo sapiens component 5 DNA.
Gene Synonym:CPAMD4, FLJ17816, FLJ17822, MGC142298
Restriction Site:
Sequence Description:
Shipping Carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-Myc Vector Information
Vector Name pCMV3-C-Myc
Vector Size 6164bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag Myc
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-C-Myc Physical Map

Schematic of pCMV3-C-Myc Multiple Cloning Sites

Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Related Products
Product nameProduct name

C5a is a protein fragment released from complement component C5. This 74 amino acid peptide in humans is generated by the cleavage of C5a convertase on the C5 α-chain during the classical, alternative, and lectin pathways of complement activation. The structure of C5a includes a core region consisting of four, anti-parallel alpha-helices held together by three disulfide linkages and a structured C-terminal tail, and C5a is rapidly metabolised by carboxypeptidase B to a 73 amino acid low activity form, C5a des-Arg. C5a is an extremely potent proinflammatory mediator, as well as a potent chemotactic factor for neutrophils and other leukocytes. It causes histamine release, increases in vascular permeability, induces several cytokines production from leukocytes, enhances neutrophil-endothelial cell adhesion, and augments the humoral and cell-mediated immune response. C5a is quickly metabolised by carboxypeptidases, forming the less potent C5adesArg. Acting via a classical G protein-coupled receptor, CD88, C5a and C5adesArg exert a number of effects essential to the innate immune response, while their actions at the more recently discovered non-G protein-coupled receptor, C5L2 (or GPR77), remain unclear. The widespread expression of C5a receptors throughout the body allows C5a to elicit a broad range of effects. Thus, C5a has been found to be a significant pathogenic driver in a number of immuno-inflammatory diseases, making C5a inhibition an attractive therapeutic strategy. C5a is a strong chemoattractant and is involved in the recruitment of inflammatory cells such as neutrophils, eosinophils, monocytes, and T lymphocytes, in activation of phagocytic cells and release of granule-based enzymes and generation of oxidants, all of which may contribute to innate immune functions or tissue damage. Accordingly, the anaphylatoxin C5a is implicated in a variety of diseases such as rheumatoid arthritis, systemic lupus erythematosus, reperfusion injury, Alzheimer's disease, and sepsis.

  • Guo RF, et al.. (2005) Role of C5a in inflammatory responses. Annu Rev Immunol. 23: 821-52.
  • Guo RF, et al. (2006) C5a, a therapeutic target in sepsis. Recent Pat Antiinfect Drug Discov. 1(1): 57-65.
  • Manthey HD, et al. (2009) Complement component 5a (C5a). Int J Biochem Cell Biol. 41(11): 2114-7.