Commande rapide

Humain Carbonic Anhydrase II expression plasmide de Gène l'ADNc ORF clone, C-HA Marqueur

    Fiche techniqueCommentairesProduits apparentésProtocoles
    Humain CA2 Informations sur les produits clonés de cDNA
    Gene_bank_ref_id:NM_000067.2
    Taille du ADNc:783bp
    Description du ADNc:Full length Clone DNA of Homo sapiens carbonic anhydrase II with C terminal HA tag.
    Synonyme du gène:CAII, Car2, CA-II, CA2
    Espèces:Human
    Vecteur:pCMV3-C-HA
    Plasmid:
    Site de restriction:
    Séquence du marqueur:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
    Description de la séquence:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with CA2 qPCR primers for gene expression analysis, HP100500 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Stockage:The lyophilized plasmid can be stored at room temperature for three months.
    HA Tag Info

    Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

    The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

    Humain Carbonic Anhydrase II expression plasmide de Gène l'ADNc ORF clone, C-HA Marqueur on other vectors
    Humain Carbonic Anhydrase II expression plasmide de Gène l'ADNc ORF clone, C-GFPSpark MarqueurHG10478-ACGCHF270
    Humain Carbonic Anhydrase II expression plasmide de Gène l'ADNc ORF clone, C-OFPSpark MarqueurHG10478-ACRCHF270
    Humain Carbonic Anhydrase II expression plasmide de Gène l'ADNc ORF clone, N-GFPSpark MarqueurHG10478-ANGCHF270
    Humain Carbonic Anhydrase II expression plasmide de Gène l'ADNc ORF clone, N-OFPSpark MarqueurHG10478-ANRCHF270
    Humain Carbonic Anhydrase II expression plasmide de Gène l'ADNc ORF clone, C-Flag MarqueurHG10478-CFCHF230
    Humain Carbonic Anhydrase II expression plasmide de Gène l'ADNc ORF clone, C-His MarqueurHG10478-CHCHF230
    Humain Carbonic Anhydrase II expression plasmide de Gène l'ADNc ORF clone, C-Myc MarqueurHG10478-CMCHF230
    Humain Carbonic Anhydrase II expression plasmide de Gène l'ADNc ORF clone, C-HA MarqueurHG10478-CYCHF230
    Humain Carbonic Anhydrase II Gène ADNc clone le vecteur de clonageHG10478-MCHF90
    Humain Carbonic Anhydrase II expression plasmide de Gène l'ADNc ORF clone, N-Flag MarqueurHG10478-NFCHF230
    Humain Carbonic Anhydrase II expression plasmide de Gène l'ADNc ORF clone, N-His MarqueurHG10478-NHCHF230
    Humain Carbonic Anhydrase II expression plasmide de Gène l'ADNc ORF clone, N-Myc MarqueurHG10478-NMCHF230
    Humain Carbonic Anhydrase II expression plasmide de Gène l'ADNc ORF clone, N-HA MarqueurHG10478-NYCHF230
    Humain Carbonic Anhydrase II expression plasmide de Gène l'ADNc ORF cloneHG10478-UTCHF230
     En savoir plus sur les vecteurs d'expression
    Product nameProduct name
    Fond

    The carbonic anhydrases (or carbonate dehydratases) are classified as metalloenzyme for its zinc ion prosthetic group and form a family of enzymes that catalyze the rapid interconversion of carbon dioxide and water to bicarbonate and protons, a reversible reaction that takes part in maintaining acid-base balance in blood and other tissues. The carbonic anhydrasekl (CA) family consists of at least 11 enzymatically active members and a few inactive homologous proteins. Carbonic anhydrase II is one of fourteen forms of human α carbonic anhydrases. Defects in this enzyme are associated with osteopetrosis and renal tubular acidosis. Renal carbonic anhydrase allows the reabsorption of sodium ions in the proximal tubule. Carbonic anhydrase II has been shown to interact with Band 3 and Sodium-hydrogen antiporter 1.

    Références
  • Lehtonen J, et al. (2004) Characterization of CA XIII, a Novel Member of the Carbonic Anhydrase Isozyme Family. The Journal of Biological Chemistry. 279: 2719-27.
  • Lindskog S. (1997) Structure and mechanism of carbonic anhydrase. Pharmacology & Therapeutics. 74(1):1-20.
  • Lilias A, et al. (1972) Crystal Structure of Human Carbonic Anhydrase C. Nature new biology. 235: 131-7.
  • Li XJ, et al. (2002) Carbonic Anhydrase II Binds to and Enhances Activity of the Na+/H+ Exchanger. The Journal of Biological Chemistry. 277: 36085-91.
  • Size / Price
    Catalogue : HG10478-CY
    Prix catalogue : 
    Prix :      (You Save: )
    Taille :
    Quantité :+-
    Disponibilité
    Ajouter au panierBulk Discount Requiry

    Datasheet & Documentation

    Contact Us
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Veuillez noter : Tous les produits sont « DESTINÉS À LA RECHERCHE UNIQUEMENT ET NE SONT PAS PRÉVUS POUR ÊTRE UTILISÉS À DES FINS DE DIAGNOSTIC OU THÉRAPEUTIQUES »