After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Commande rapide

Text Size:AAA

Humain Carbonic Anhydrase II expression plasmide de Gène l'ADNc ORF clone, C-HA Marqueur

Fiche techniqueCommentairesProduits apparentésProtocoles
Human CA2 Informations sur les produits clonés de cDNA
Gene_bank_ref_id:NM_000067.2
Taille du ADNc:783bp
Description du ADNc:Full length Clone DNA of Homo sapiens carbonic anhydrase II with C terminal HA tag.
Synonyme du gène:CAII, Car2, CA-II, CA2
Espèces:Human
Vecteur:pCMV3-C-HA
Plasmid:
Site de restriction:
Séquence du marqueur:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Description de la séquence:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Humain Carbonic Anhydrase II expression plasmide de Gène l'ADNc ORF clone, C-HA Marqueur on other vectors
Humain Carbonic Anhydrase II expression plasmide de Gène l'ADNc ORF clone, C-GFPSpark MarqueurHG10478-ACGCHF270
Humain Carbonic Anhydrase II expression plasmide de Gène l'ADNc ORF clone, C-OFPSpark MarqueurHG10478-ACRCHF270
Humain Carbonic Anhydrase II expression plasmide de Gène l'ADNc ORF clone, N-GFPSpark MarqueurHG10478-ANGCHF270
Humain Carbonic Anhydrase II expression plasmide de Gène l'ADNc ORF clone, N-OFPSpark MarqueurHG10478-ANRCHF270
Humain Carbonic Anhydrase II expression plasmide de Gène l'ADNc ORF clone, C-Flag MarqueurHG10478-CFCHF234
Humain Carbonic Anhydrase II expression plasmide de Gène l'ADNc ORF clone, C-His MarqueurHG10478-CHCHF234
Humain Carbonic Anhydrase II expression plasmide de Gène l'ADNc ORF clone, C-Myc MarqueurHG10478-CMCHF234
Humain Carbonic Anhydrase II expression plasmide de Gène l'ADNc ORF clone, C-Myc MarqueurHG10478-CMCHF234
Humain Carbonic Anhydrase II expression plasmide de Gène l'ADNc ORF clone, C-HA MarqueurHG10478-CYCHF234
Humain Carbonic Anhydrase II Gène ADNc clone le vecteur de clonageHG10478-MCHF90
Humain Carbonic Anhydrase II expression plasmide de Gène l'ADNc ORF clone, N-Flag MarqueurHG10478-NFCHF234
Humain Carbonic Anhydrase II expression plasmide de Gène l'ADNc ORF clone, N-His MarqueurHG10478-NHCHF234
Humain Carbonic Anhydrase II expression plasmide de Gène l'ADNc ORF clone, N-Myc MarqueurHG10478-NMCHF234
Humain Carbonic Anhydrase II expression plasmide de Gène l'ADNc ORF clone, N-HA MarqueurHG10478-NYCHF234
Humain Carbonic Anhydrase II expression plasmide de Gène l'ADNc ORF cloneHG10478-UTCHF234
 En savoir plus sur les vecteurs d'expression
Product nameProduct name
Fond

The carbonic anhydrases (or carbonate dehydratases) are classified as metalloenzyme for its zinc ion prosthetic group and form a family of enzymes that catalyze the rapid interconversion of carbon dioxide and water to bicarbonate and protons, a reversible reaction that takes part in maintaining acid-base balance in blood and other tissues. The carbonic anhydrasekl (CA) family consists of at least 11 enzymatically active members and a few inactive homologous proteins. Carbonic anhydrase II is one of fourteen forms of human α carbonic anhydrases. Defects in this enzyme are associated with osteopetrosis and renal tubular acidosis. Renal carbonic anhydrase allows the reabsorption of sodium ions in the proximal tubule. Carbonic anhydrase II has been shown to interact with Band 3 and Sodium-hydrogen antiporter 1.

Références
  • Lehtonen J, et al. (2004) Characterization of CA XIII, a Novel Member of the Carbonic Anhydrase Isozyme Family. The Journal of Biological Chemistry. 279: 2719-27.
  • Lindskog S. (1997) Structure and mechanism of carbonic anhydrase. Pharmacology & Therapeutics. 74(1):1-20.
  • Lilias A, et al. (1972) Crystal Structure of Human Carbonic Anhydrase C. Nature new biology. 235: 131-7.
  • Li XJ, et al. (2002) Carbonic Anhydrase II Binds to and Enhances Activity of the Na+/H+ Exchanger. The Journal of Biological Chemistry. 277: 36085-91.
  • Size / Price
    Catalogue : HG10478-CY
    Prix catalogue : 
    Prix :      (You Save: )
    Taille :
    Quantité :+-
    Disponibilité2-3 weeks
    Bulk Discount RequiryAjouter au panier
    Contact Us
    Images
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Veuillez noter : Tous les produits sont « DESTINÉS À LA RECHERCHE UNIQUEMENT ET NE SONT PAS PRÉVUS POUR ÊTRE UTILISÉS À DES FINS DE DIAGNOSTIC OU THÉRAPEUTIQUES »