After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Commande rapide

Text Size:AAA

Humain Carbonic Anhydrase IX/CA9 expression plasmide de Gène l'ADNc ORF clone, N-His Marqueur

Fiche techniqueCommentairesProduits apparentésProtocoles
Human CA9 Informations sur les produits clonés de cDNA
Gene_bank_ref_id:NM_001216.2
Taille du ADNc:1380bp
Description du ADNc:Full length Clone DNA of Homo sapiens carbonic anhydrase IX with N terminal His tag.
Synonyme du gène:CA9, MN, CAIX
Espèces:Human
Vecteur:pCMV3-N-His
Plasmid:
Site de restriction:
Séquence du marqueur:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Description de la séquence:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Humain Carbonic Anhydrase IX/CA9 expression plasmide de Gène l'ADNc ORF clone, N-His Marqueur on other vectors
Humain Carbonic Anhydrase IX/CA9 expression plasmide de Gène l'ADNc ORF clone, C-GFPSpark MarqueurHG10107-ACGCHF270
Humain Carbonic Anhydrase IX/CA9 expression plasmide de Gène l'ADNc ORF clone, C-OFPSpark MarqueurHG10107-ACRCHF270
Humain Carbonic Anhydrase IX/CA9 expression plasmide de Gène l'ADNc ORF clone, N-GFPSpark MarqueurHG10107-ANGCHF270
Humain Carbonic Anhydrase IX/CA9 expression plasmide de Gène l'ADNc ORF clone, N-OFPSpark MarqueurHG10107-ANRCHF270
Humain Carbonic Anhydrase IX/CA9 expression plasmide de Gène l'ADNc ORF clone, C-Flag MarqueurHG10107-CFCHF230
Humain Carbonic Anhydrase IX/CA9 expression plasmide de Gène l'ADNc ORF clone, C-His MarqueurHG10107-CHCHF230
Humain Carbonic Anhydrase IX/CA9 expression plasmide de Gène l'ADNc ORF clone, C-Myc MarqueurHG10107-CMCHF230
Humain Carbonic Anhydrase IX/CA9 expression plasmide de Gène l'ADNc ORF clone, C-HA MarqueurHG10107-CYCHF230
Humain Carbonic Anhydrase IX/CA9 Gène ADNc clone le vecteur de clonageHG10107-MCHF90
Humain Carbonic Anhydrase IX/CA9 expression plasmide de Gène l'ADNc ORF clone, N-Flag MarqueurHG10107-NFCHF230
Humain Carbonic Anhydrase IX/CA9 expression plasmide de Gène l'ADNc ORF clone, N-His MarqueurHG10107-NHCHF230
Humain Carbonic Anhydrase IX/CA9 expression plasmide de Gène l'ADNc ORF clone, N-Myc MarqueurHG10107-NMCHF230
Humain Carbonic Anhydrase IX/CA9 expression plasmide de Gène l'ADNc ORF clone, N-HA MarqueurHG10107-NYCHF230
Humain Carbonic Anhydrase IX/CA9 expression plasmide de Gène l'ADNc ORF cloneHG10107-UTCHF230
 En savoir plus sur les vecteurs d'expression
Product nameProduct name
Fond

Carbonic anhydrases IX (CA IX), also known as membrane antigen MN or CA9, is a member of the carbonic anhydrase (CA) family and may be involved in cell proliferation and cellular transformation. CAs are zinc metalloenzymes that catalyze the reversible hydration of carbon dioxide (H2O + CO2 = H+ + HCO3–) and thus participate in a variety of biological and physical processes. CA IX protein is expressed primarily in carcinoma cells lines, and the expression is cell density dependent and has been shown to be strongly induced by hypoxia, accordingly facilitates adaptation of tumor cells to hypoxic conditions. It is involved in tumorigenesis through many pathways, such as pH regulation and cell adhesion control. CA IX is used as a marker of tumor hypoxia and as a new therapeutic target for many human carcinomas and cancers.

Références
  • Loncaster JA, et al. (2001) Carbonic anhydrase (CA IX) expression, a potential new intrinsic marker of hypoxia: correlations with tumor oxygen measurements and prognosis in locally advanced carcinoma of the cervix. Cancer Res. 61(17): 6394-9.
  • Zvada J, et al. (2003) Soluble form of carbonic anhydrase IX (CA IX) in the serum and urine of renal carcinoma patients. Br J Cancer. 89(6): 1067-71.
  • Pan P, et al. (2006) Carbonic anhydrase gene expression in CA II-deficient (Car2-/-) and CA IX-deficient (Car9-/-) mice. J Physiol. 571(Pt 2): 319-27.
  • Zhou GX, et al. (2010) Quantification of carbonic anhydrase IX expression in serum and tissue of renal cell carcinoma patients using enzyme-linked immunosorbent assay: prognostic and diagnostic potentials. Urology. 75(2): 257-61.
  • Size / Price
    Catalogue : HG10107-NH
    Prix catalogue : 
    Prix :      (You Save: )
    Taille :
    Quantité :+-
    Disponibilité2-3 weeks
    Bulk Discount RequiryAjouter au panier
    Contact Us
    Images
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Veuillez noter : Tous les produits sont « DESTINÉS À LA RECHERCHE UNIQUEMENT ET NE SONT PAS PRÉVUS POUR ÊTRE UTILISÉS À DES FINS DE DIAGNOSTIC OU THÉRAPEUTIQUES »