Commande rapide

Humain Carbonic Anhydrase XIII/CA13 expression plasmide de Gène l'ADNc ORF clone, C-His Marqueur

Fiche techniqueCommentairesProduits apparentésProtocoles
Human CA13 Informations sur les produits clonés de cDNA
Taille du ADNc:789bp
Description du ADNc:Full length Clone DNA of Homo sapiens carbonic anhydrase XIII with C terminal His tag.
Synonyme du gène:CAXIII, FLJ37995, MGC59868, CA13
Site de restriction:
Séquence du marqueur:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Description de la séquence:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Humain Carbonic Anhydrase XIII/CA13 expression plasmide de Gène l'ADNc ORF clone, C-His Marqueur on other vectors
Humain Carbonic Anhydrase XIII/CA13 expression plasmide de Gène l'ADNc ORF clone, C-GFPSpark MarqueurHG10461-ACGCHF270
Humain Carbonic Anhydrase XIII/CA13 expression plasmide de Gène l'ADNc ORF clone, C-OFPSpark MarqueurHG10461-ACRCHF270
Humain Carbonic Anhydrase XIII/CA13 expression plasmide de Gène l'ADNc ORF clone, N-GFPSpark MarqueurHG10461-ANGCHF270
Humain Carbonic Anhydrase XIII/CA13 expression plasmide de Gène l'ADNc ORF clone, N-OFPSpark MarqueurHG10461-ANRCHF270
Humain Carbonic Anhydrase XIII/CA13 expression plasmide de Gène l'ADNc ORF clone, C-Flag MarqueurHG10461-CFCHF230
Humain Carbonic Anhydrase XIII/CA13 expression plasmide de Gène l'ADNc ORF clone, C-His MarqueurHG10461-CHCHF230
Humain Carbonic Anhydrase XIII/CA13 expression plasmide de Gène l'ADNc ORF clone, C-Myc MarqueurHG10461-CMCHF230
Humain Carbonic Anhydrase XIII/CA13 expression plasmide de Gène l'ADNc ORF clone, C-HA MarqueurHG10461-CYCHF230
Humain Carbonic Anhydrase XIII/CA13 Gène ADNc clone le vecteur de clonageHG10461-MCHF90
Humain Carbonic Anhydrase XIII/CA13 expression plasmide de Gène l'ADNc ORF clone, C-Flag MarqueurHG10461-M-FCHF230
Humain Carbonic Anhydrase XIII/CA13 expression plasmide de Gène l'ADNc ORF clone, N-Flag MarqueurHG10461-NFCHF230
Humain Carbonic Anhydrase XIII/CA13 expression plasmide de Gène l'ADNc ORF clone, N-His MarqueurHG10461-NHCHF230
Humain Carbonic Anhydrase XIII/CA13 expression plasmide de Gène l'ADNc ORF clone, N-Myc MarqueurHG10461-NMCHF230
Humain Carbonic Anhydrase XIII/CA13 expression plasmide de Gène l'ADNc ORF clone, N-HA MarqueurHG10461-NYCHF230
Humain Carbonic Anhydrase XIII/CA13 expression plasmide de Gène l'ADNc ORF cloneHG10461-UTCHF230
 En savoir plus sur les vecteurs d'expression
Product nameProduct name

The carbonic anhydrases (or carbonate dehydratases) are classified as metalloenzyme for its zinc ion prosthetic group and form a family of enzymes that catalyze the rapid interconversion of carbon dioxide and water to bicarbonate and protons, a reversible reaction that takes part in maintaining acid-base balance in blood and other tissues. The carbonic anhydrasekl (CA) family consists of at least 11 enzymatically active members and a few inactive homologous proteins. The CAXIII is a member of the CA family, which owns a globular molecule with high structural similarity to cytosolic isozymes, CAI, II, and III. Recombinant mouse CAXIII showed catalytic activity similar to those of mitochondrial CAV and cytosolic CAI. In human tissues, CAXIII expression was identified in the thymus, small intestine, spleen, prostate, ovary, colon, and testis. In mouse, positive tissues included the spleen, lung, kidney, heart, brain, skeletal muscle, and testis. In conclusion, the predicted amino acid sequence, structural model, distribution, and activity data suggest that CAXIII represents a novel enzyme, which may play important physiological roles in several organs.

  • Lehtonen J, et al. (2004) Characterization of CA XIII, a Novel Member of the Carbonic Anhydrase Isozyme Family. The Journal of Biological Chemistry. 279: 2719-27.
  • Lindskog S. (1997) Structure and mechanism of carbonic anhydrase. Pharmacology & Therapeutics. 74(1):1-20.
  • Lehtonen J, et al. (2004) Characterization of CA XIII, a Novel Member of the Carbonic Anhydrase Isozyme Family. The Journal of Biological Chemistry. 279: 2719-27.
  • Size / Price
    Catalogue : HG10461-CH
    Prix catalogue : 
    Prix :      (You Save: )
    Taille :
    Quantité :+-
    Disponibilité2-3 weeks
    Bulk Discount RequiryAjouter au panier
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.