Commande rapide

Text Size:AAA

Humain Carbonic Anhydrase VA/CA5A expression plasmide de Gène l'ADNc ORF clone, C-HA Marqueur

Fiche techniqueCommentairesProduits apparentésProtocoles
Human CA5A Informations sur les produits clonés de cDNA
Taille du ADNc:918bp
Description du ADNc:Full length Clone DNA of Homo sapiens carbonic anhydrase VA, mitochondrial with C terminal HA tag.
Synonyme du gène:CA5, CAV, CAVA
Site de restriction:
Séquence du marqueur:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Description de la séquence:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Humain Carbonic Anhydrase VA/CA5A expression plasmide de Gène l'ADNc ORF clone, C-HA Marqueur on other vectors
Humain Carbonic Anhydrase VA/CA5A expression plasmide de Gène l'ADNc ORF clone, C-GFPSpark MarqueurHG10500-ACGCHF270
Humain Carbonic Anhydrase VA/CA5A expression plasmide de Gène l'ADNc ORF clone, C-OFPSpark MarqueurHG10500-ACRCHF270
Humain Carbonic Anhydrase VA/CA5A expression plasmide de Gène l'ADNc ORF clone, N-GFPSpark MarqueurHG10500-ANGCHF270
Humain Carbonic Anhydrase VA/CA5A expression plasmide de Gène l'ADNc ORF clone, N-OFPSpark MarqueurHG10500-ANRCHF270
Humain Carbonic Anhydrase VA/CA5A expression plasmide de Gène l'ADNc ORF clone, C-Flag MarqueurHG10500-CFCHF230
Humain Carbonic Anhydrase VA/CA5A expression plasmide de Gène l'ADNc ORF clone, C-His MarqueurHG10500-CHCHF230
Humain Carbonic Anhydrase VA/CA5A expression plasmide de Gène l'ADNc ORF clone, C-Myc MarqueurHG10500-CMCHF230
Humain Carbonic Anhydrase VA/CA5A expression plasmide de Gène l'ADNc ORF clone, C-HA MarqueurHG10500-CYCHF230
Humain Carbonic Anhydrase VA/CA5A Gène ADNc clone le vecteur de clonageHG10500-MCHF90
Humain Carbonic Anhydrase VA/CA5A expression plasmide de Gène l'ADNc ORF clone, N-Flag MarqueurHG10500-NFCHF230
Humain Carbonic Anhydrase VA/CA5A expression plasmide de Gène l'ADNc ORF clone, N-His MarqueurHG10500-NHCHF230
Humain Carbonic Anhydrase VA/CA5A expression plasmide de Gène l'ADNc ORF clone, N-Myc MarqueurHG10500-NMCHF230
Humain Carbonic Anhydrase VA/CA5A expression plasmide de Gène l'ADNc ORF clone, N-HA MarqueurHG10500-NYCHF230
Humain Carbonic Anhydrase VA/CA5A expression plasmide de Gène l'ADNc ORF cloneHG10500-UTCHF230
 En savoir plus sur les vecteurs d'expression
Product nameProduct name

Carbonic anhydrase 5A, mitochondrial, also known as Carbonate dehydratase VA, Carbonic anhydrase VA, CA-VA and CA5A, is a member of the alpha-carbonic anhydrase family. Carbonic anhydrases (CAs) are a large family of zinc metalloenzymes first discovered in 1933 that catalyze the reversible hydration of carbon dioxide. CAs participate in a variety of biological processes, including respiration, calcification, acid-base balance, bone resorption, and the formation of aqueous humor, cerebrospinal fluid, saliva, and gastric acid. CA5A / CA-VA is activated by histamine, L-adrenaline, L- and D-histidine, and L- and D-phenylalanine. It is inhibited by coumarins, sulfonamide derivatives such as acetazolamide and Foscarnet (phosphonoformate trisodium salt).

  • Strausberg, R.L. et al., 2002, Proc. Natl. Acad. Sci. USA 99:16899 - 903.
  • Liao, S.Y. et al., 2003, J. Med. Genet. 40:257 - 262.
  • Temperini al., 2006, Chemistry 12: 7057-66.
  • Temperini al., 2006, J. Med. Chem. 49: 3019-27.
  • Supuran, C. T. et al., 2008, Curr Pharm Des. 14 (7): 601-602.
  • Elleuche, S. et al., 2009, Curr Genet. 55 (2): 211-222.
  • Size / Price
    Catalogue : HG10500-CY
    Prix catalogue : 
    Prix :      (You Save: )
    Taille :
    Quantité :+-
    Disponibilité2-3 weeks
    Bulk Discount RequiryAjouter au panier
    Contact Us
        Articles consultés récemment
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.