CA5A cDNA ORF Clone, Human, N-HA tag

Cat: HG10500-NY

Contact us:

215-583-7898
order_us@sinobiological.com
Distributors

All CA5A Reagents

CRO Services

Product recommended


All CA5A Reagents

CA5A cDNA ORF Clone, Human, N-HA tag General Information

Gene

Species
Human
NCBI Ref Seq
RefSeq ORF Size
918 bp
Description
Full length Clone DNA of Human carbonic anhydrase VA, mitochondrial with N terminal HA tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

CA5A cDNA ORF Clone, Human, N-HA tag Alternative Names

CA5 cDNA ORF Clone, Human;CA5AD cDNA ORF Clone, Human;CA5D cDNA ORF Clone, Human;Carbonic Anhydrase VA cDNA ORF Clone, Human;CAV cDNA ORF Clone, Human;CAVA cDNA ORF Clone, Human;GS1-21A4.1 cDNA ORF Clone, Human

CA5A Background Information

Carbonic anhydrase 5A, mitochondrial, also known as Carbonate dehydratase VA, Carbonic anhydrase VA, CA-VA and CA5A, is a member of the alpha-carbonic anhydrase family. Carbonic anhydrases (CAs) are a large family of zinc metalloenzymes first discovered in 1933 that catalyze the reversible hydration of carbon dioxide. CAs participate in a variety of biological processes, including respiration, calcification, acid-base balance, bone resorption, and the formation of aqueous humor, cerebrospinal fluid, saliva, and gastric acid. CA5A / CA-VA is activated by histamine, L-adrenaline, L- and D-histidine, and L- and D-phenylalanine. It is inhibited by coumarins, sulfonamide derivatives such as acetazolamide and Foscarnet (phosphonoformate trisodium salt).
Full Name
carbonic anhydrase VA, mitochondrial
References
  • Strausberg, R.L. et al., 2002, Proc. Natl. Acad. Sci. USA 99:16899 - 903.
  • Liao, S.Y. et al., 2003, J. Med. Genet. 40:257 - 262.
  • Temperini C.et al., 2006, Chemistry 12: 7057-66.
  • Temperini C.et al., 2006, J. Med. Chem. 49: 3019-27.
  • Supuran, C. T. et al., 2008, Curr Pharm Des. 14 (7): 601-602.
  • Elleuche, S. et al., 2009, Curr Genet. 55 (2): 211-222.
  • CA5A cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    CA5A cDNA ORF Clone in Cloning Vector, Mouse MG50779-G
    CA5A cDNA ORF Clone, Mouse, untagged MG50779-UT
    CA5A Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50779-ACGLN
    CA5A cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50779-ACG
    CA5A cDNA ORF Clone, Mouse, N-GFPSpark® tag MG50779-ANG
    CA5A cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50779-ACR
    CA5A cDNA ORF Clone, Mouse, N-OFPSpark® tag MG50779-ANR
    CA5A cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50779-CF
    CA5A cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50779-NF
    CA5A cDNA ORF Clone, Mouse, C-His tag MG50779-CH
    CA5A cDNA ORF Clone, Mouse, N-His tag MG50779-NH
    CA5A cDNA ORF Clone, Mouse, C-HA tag MG50779-CY
    CA5A cDNA ORF Clone, Mouse, N-HA tag MG50779-NY
    CA5A cDNA ORF Clone, Mouse, C-Myc tag MG50779-CM
    CA5A cDNA ORF Clone, Mouse, N-Myc tag MG50779-NM
    CA5A qPCR Primer Pairs, Mouse MP200753

    CA5A cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    CA5A cDNA ORF Clone in Cloning Vector, Human HG10500-M
    CA5A cDNA ORF Clone, Human, untagged HG10500-UT
    CA5A Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10500-ACGLN
    CA5A cDNA ORF Clone, Human, C-GFPSpark® tag HG10500-ACG
    CA5A cDNA ORF Clone, Human, N-GFPSpark® tag HG10500-ANG
    CA5A cDNA ORF Clone, Human, C-OFPSpark® tag HG10500-ACR
    CA5A cDNA ORF Clone, Human, N-OFPSpark® tag HG10500-ANR
    CA5A cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10500-CF
    CA5A cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10500-NF
    CA5A cDNA ORF Clone, Human, C-His tag HG10500-CH
    CA5A cDNA ORF Clone, Human, N-His tag HG10500-NH
    CA5A cDNA ORF Clone, Human, C-HA tag HG10500-CY
    CA5A cDNA ORF Clone, Human, C-Myc tag HG10500-CM
    CA5A cDNA ORF Clone, Human, N-Myc tag HG10500-NM
    CA5A qPCR Primer Pairs, Human HP100521
    info info
    添加购物车成功! 添加购物车失败!