CANT1 cDNA ORF Clone, Human, C-Myc tag

Price:
Size:
Number:

CANT1 cDNA ORF Clone, Human, C-Myc tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1206 bp
Description
Full length Clone DNA of Human calcium activated nucleotidase 1 with C terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

CANT1 cDNA ORF Clone, Human, C-Myc tag: Alternative Names

DBQD cDNA ORF Clone, Human; SCAN-1 cDNA ORF Clone, Human; SCAN1 cDNA ORF Clone, Human; SHAPY cDNA ORF Clone, Human

CANT1 Background Information

CANT1(calcium activated nucleotidase 1) belongs to the apyrase family. Apyrase is a calcium-activated plasma membrane-bound enzyme (magnesium can also activate it) (EC 3.6.1.5) that catalyses the hydrolysis of ATP to yield AMP and inorganic phosphate. Two isoenzymes are found in commercial preparations from S. tuberosum. One with a higher ratio of substrate selectivity for ATP: ADP and another with no selectivity. It can also act on ADP and other nucleoside triphosphates and diphosphates with the general reaction being NTP -> NDP + Pi -> NMP + 2Pi. The salivary apyrases of blood-feeding arthropods are nucleotide hydrolysing enzymes are implicated in the inhibition of host platelet aggregation through the hydrolysis of extracellular adenosine diphosphate. CANT1 functions as a calcium-dependent nucleotidase with a preference for UDP. Defects in CANT1 are the cause of desbuquois dysplasia.
Full Name
calcium activated nucleotidase 1
References
  • Failer BU, et al. (2002) Cloning, expression, and functional characterization of a Ca(2+)-dependent endoplasmic reticulum nucleoside diphosphatase. J Biol Chem. 277(40):36978-86.
  • Smith TM, et al. (2002) Cloning, expression, and characterization of a soluble calcium-activated nucleotidase, a human enzyme belonging to a new family of extracellular nucleotidases. Arch Biochem Biophys. 406(1):105-15.
  • Strausberg RL, et al. (2003) Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences. Proc Natl Acad Sci. 99(26):16899-903.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait