Commande rapide

Text Size:AAA

Humain CAPG / AFCP expression plasmide de Gène l'ADNc ORF clone

Fiche techniqueCommentairesProduits apparentésProtocoles
Human CAPG Informations sur les produits clonés de cDNA
Gene_bank_ref_id:BC014549
Taille du ADNc:1047bp
Description du ADNc:Full length Clone DNA of Homo sapiens capping protein (actin filament), gelsolin-like.
Synonyme du gène:AFCP, MCP, CAPG
Espèces:Human
Vecteur:pCMV3-untagged
Plasmid:
Site de restriction:
Séquence du marqueur:
Description de la séquence:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
Fond

CAPG, also known as actin Regulatory Protein CAPG, is a a member of the gelsolin/villin family. Members of this family are actin-regulatory proteins. CAPG reversibly blocks the barbed ends of F-actin filaments in a Ca2+ and phosphoinositide-regulated manner, but does not sever preformed actin filaments. By capping the barbed ends of actin filaments, CAPG contributes to the control of actin-based motility in non-muscle cells. CAPG may also play an important role in macrophage function.

Références
  • Watari A. et al., 2007, Oncogene. 25 (56): 7373-80.
  • De Corte V. et al., 2005, J Cell Sci. 117 (22): 5283-92.
  • Van Impe K. et al., 2003, J Biol Chem. 278 (20): 17945-52.
  • Size / Price
    Catalogue : HG14213-UT
    Prix catalogue : 
    Prix :      (You Save: )
    Taille :
    Quantité :+-
    Disponibilité2-3 weeks
    Bulk Discount RequiryAjouter au panier
    Contact Us
    Images
        Articles consultés récemment
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Veuillez noter : Tous les produits sont « DESTINÉS À LA RECHERCHE UNIQUEMENT ET NE SONT PAS PRÉVUS POUR ÊTRE UTILISÉS À DES FINS DE DIAGNOSTIC OU THÉRAPEUTIQUES »