After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Humain Caspase 4 transcript variant alpha expression plasmide de Gène l'ADNc ORF clone, N-HA Marqueur

Fiche techniqueCommentairesProduits apparentésProtocoles
Human CASP4 Informations sur les produits clonés de cDNA
Gene_bank_ref_id:NM_001225.3
Taille du ADNc:1134bp
Description du ADNc:Full length Clone DNA of Homo sapiens caspase 4, apoptosis-related cysteine peptidase, transcript variant alpha with N terminal HA tag.
Synonyme du gène:TX, ICH-2, Mih1/TX, ICEREL-II, ICE(rel)II, CASP4
Espèces:Human
Vecteur:pCMV3-N-HA
Plasmid:
Site de restriction:
Séquence du marqueur:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Description de la séquence:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Humain Caspase 4 transcript variant alpha expression plasmide de Gène l'ADNc ORF clone, N-HA Marqueur on other vectors
Humain Caspase 4 transcript variant alpha expression plasmide de Gène l'ADNc ORF clone, C-GFPSpark MarqueurHG11158-ACGCHF270
Humain Caspase 4 transcript variant alpha expression plasmide de Gène l'ADNc ORF clone, C-OFPSpark MarqueurHG11158-ACRCHF270
Humain Caspase 4 transcript variant alpha expression plasmide de Gène l'ADNc ORF clone, N-GFPSpark MarqueurHG11158-ANGCHF270
Humain Caspase 4 transcript variant alpha expression plasmide de Gène l'ADNc ORF clone, N-OFPSpark MarqueurHG11158-ANRCHF270
Humain Caspase 4 transcript variant alpha expression plasmide de Gène l'ADNc ORF clone, C-Flag MarqueurHG11158-CFCHF230
Humain Caspase 4 transcript variant alpha expression plasmide de Gène l'ADNc ORF clone, C-His MarqueurHG11158-CHCHF230
Humain Caspase 4 transcript variant alpha expression plasmide de Gène l'ADNc ORF clone, C-Myc MarqueurHG11158-CMCHF230
Humain Caspase 4 transcript variant alpha expression plasmide de Gène l'ADNc ORF clone, C-HA MarqueurHG11158-CYCHF230
Humain Caspase 4 transcript variant alpha Gène ADNc clone le vecteur de clonageHG11158-MCHF90
Humain Caspase 4 transcript variant alpha expression plasmide de Gène l'ADNc ORF clone, C-Flag MarqueurHG11158-M-FCHF230
Humain Caspase 4 transcript variant alpha expression plasmide de Gène l'ADNc ORF clone, N-Flag MarqueurHG11158-NFCHF230
Humain Caspase 4 transcript variant alpha expression plasmide de Gène l'ADNc ORF clone, N-His MarqueurHG11158-NHCHF230
Humain Caspase 4 transcript variant alpha expression plasmide de Gène l'ADNc ORF clone, N-Myc MarqueurHG11158-NMCHF230
Humain Caspase 4 transcript variant alpha expression plasmide de Gène l'ADNc ORF clone, N-HA MarqueurHG11158-NYCHF230
Humain Caspase 4 transcript variant alpha expression plasmide de Gène l'ADNc ORF cloneHG11158-UTCHF230
 En savoir plus sur les vecteurs d'expression
Product nameProduct name
Size / Price
Catalogue : HG11158-NY
Prix catalogue : 
Prix :      (You Save: )
Taille :
Quantité :+-
Disponibilité2-3 weeks
Bulk Discount RequiryAjouter au panier
Contact Us
Images
      Articles consultés récemment
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Veuillez noter : Tous les produits sont « DESTINÉS À LA RECHERCHE UNIQUEMENT ET NE SONT PAS PRÉVUS POUR ÊTRE UTILISÉS À DES FINS DE DIAGNOSTIC OU THÉRAPEUTIQUES »