CBR3 cDNA ORF Clone, Human, N-Myc tag

Price:
Size:
Number:

CBR3 cDNA ORF Clone, Human, N-Myc tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
834 bp
Description
Full length Clone DNA of Human carbonyl reductase 3 with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

CBR3 cDNA ORF Clone, Human, N-Myc tag: Alternative Names

hCBR3 cDNA ORF Clone, Human; HEL-S-25 cDNA ORF Clone, Human; SDR21C2 cDNA ORF Clone, Human

CBR3 Background Information

CBR3, also known as hCBR3, belongs to the short-chain dehydrogenases/reductases (SDR) family. CBR3 is expressed in ovary, pancreas, intestine, colon, kidney, brain, thymus, lung, heart, liver, spleen, leukocyte, prostate and testis. It is a monomeric NADPH-dependent oxidoreductase and is closely linked to another carbonyl reductase gene – CBR1. CBR3 catalyzes the reduction of a large number of biologically and pharmacologically active carbonyl compounds to their corresponding alcohols. It has low NADPH-dependent oxidoreductase activity towards 4-benzoylpyridine and menadione (in vitro).
Full Name
carbonyl reductase 3
References
  • Lakhman SS. et al., 2005. Drug Metab Dispos. 33 (2): 254-7.
  • Gerhard DS. et al., 2004, Genome Res. 14 (10B): 2121-7.
  • Strausberg RL. et al., 2003, Proc Natl Acad Sci. 99 (26): 16899-903.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait