CCL14 cDNA ORF Clone, Human, C-HA tag

Price:
Size:
Number:

CCL14 cDNA ORF Clone, Human, C-HA tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
282 bp
Description
Full length Clone DNA of Human chemokine (C-C motif) ligand 14 with C terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

CCL14 cDNA ORF Clone, Human, C-HA tag: Alternative Names

CC-1 cDNA ORF Clone, Human; CC-3 cDNA ORF Clone, Human; CKB1 cDNA ORF Clone, Human; FLJ16015 cDNA ORF Clone, Human; HCC-1 cDNA ORF Clone, Human; HCC-1(1-74) cDNA ORF Clone, Human; HCC-1/HCC-3 cDNA ORF Clone, Human; HCC-3 cDNA ORF Clone, Human; MCIF cDNA ORF Clone, Human; NCC-2 cDNA ORF Clone, Human; NCC2 cDNA ORF Clone, Human; SCYA14 cDNA ORF Clone, Human; SCYL2 cDNA ORF Clone, Human; SY14 cDNA ORF Clone, Human

CCL14 Background Information

CCL14 has an important biological role in other mammals by evolving under positive selection that has been lost in Ochotonidae (subgenera Pika and Lagotona). CC chemokine ligand 14, CCL14, is a human CC chemokine that is of recent interest because of its natural ability, upon proteolytic processing of the first eight NH2-terminal residues, to bind to and signal through the human immunodeficiency virus type-1 (HIV-1) co-receptor, CC chemokine receptor 5 (CCR5). Embryo implantation is a complex process involving blastocyst attachment to the endometrial epithelium and subsequent trophoblast invasion of the decidua. We have previously shown that the chemokines CX3CL1 and CCL14 are abundant in endometrial vasculature, epithelial, and decidual cells at this time, and that their receptors, CX3CR1 and CCR1, are present on invading human trophoblasts. CX3CL1 and CCL14 promote trophoblast migration.
Full Name
chemokine (C-C motif) ligand 14
References
  • Laing KJ, et al. (2004) Chemokines. Developmental and comparative immunology. 28(5): 443-60.
  • Knappe S, et al. (1996) HCC-1, a novel chemokine from human plasma. J Exp Med. 183: 295-9.
  • Naruse, et al. (1996) A YAC contig of the human CC chemokine genes clustered on chromosome 17q11.2. Genomics. 34: 236-40.
  •  

    CCL14/HCC-1/HCC-3 related areas, pathways, and other information

Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait