TARC cDNA ORF Clone, Human, N-HA tag

Price:
Size:
Number:

TARC cDNA ORF Clone, Human, N-HA tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
285 bp
Description
Full length Clone DNA of Human chemokine (C-C motif) ligand 17 with N terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

TARC cDNA ORF Clone, Human, N-HA tag: Alternative Names

A-152E5.3 cDNA ORF Clone, Human; ABCD-2 cDNA ORF Clone, Human; SCYA17 cDNA ORF Clone, Human; TARC cDNA ORF Clone, Human

TARC Background Information

Chemokines are a family of small chemotactic cytokines, or proteins secreted by cells. Chemokines share the same structure similarities such as small size, and the presence of four cysteine residues in conserved locations in order to form their 3-dimensional shape. Some of the chemokines are considered pro-inflammatory which can be induced to recruit cells of the immune system to a site of infection during an immune response, while others are considered homeostatic and are implied in controlling the migration of cells during normal processes of tissue maintenance and development. There are four members of the chemokine family: C-C kemokines, C kemokines, CXC kemokines and CX3C kemokines. The C-C kemokines have two cysteines nearby the amino terminus. There have been at least 27 distinct members of this subgroup reported for mammals, called C-C chemokine ligands-1 to 28. Chemokin ligand 17 (CCL17), also known as thymus and activation regulated chemokine(TARC), is a small cytokine belonging to the C-C chemokine family. CCL17 is expressed maily in thymus and transiently in phytohemagglutinin-stimulated peripheral blood mononuclear cells. CCL17 can induce chemotaxis in T cells by binding with the chemokine receptor CCR4.
Full Name
chemokine (C-C motif) ligand 17
References
  • Laing KJ, et al. (2004) Chemokines. Developmental and comparative immunology. 28(5): 443-60.
  • Cocchi F, et al. (1995) Identification of RANTES, MIP-1a, and MIP-1b as the major HIV-suppressive factor produced by CD8+ T cells. Science. 270 (5243): 1811-5.
  • Morita A, et al. (2002). Evaluation of human thymus and activation-regulated chemokine concentrations in blood using a new sandwich ELISA based on monoclonal antibodies. Clin Chim Acta. 322 (1-2): 67-75.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait