Commande rapide

Humain CCL20/MIP-3 alpha/MIP3A transcript variant 2 expression plasmide de Gène l'ADNc ORF clone, C-HA Marqueur

Fiche techniqueCommentairesProduits apparentésProtocoles
Human CCL20 Informations sur les produits clonés de cDNA
Taille du ADNc:288bp
Description du ADNc:Full length Clone DNA of Homo sapiens chemokine (C-C motif) ligand 20, transcript variant 2 with C terminal HA tag.
Synonyme du gène:CKb4, LARC, ST38, MIP3A, MIP-3a, SCYA20, CCL20
Site de restriction:
Séquence du marqueur:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Description de la séquence:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Humain CCL20/MIP-3 alpha/MIP3A transcript variant 2 expression plasmide de Gène l'ADNc ORF clone, C-HA Marqueur on other vectors
Humain CCL20/MIP-3 alpha/MIP3A transcript variant 2 expression plasmide de Gène l'ADNc ORF clone, C-GFPSpark MarqueurHG10485-ACGCHF270
Humain CCL20/MIP-3 alpha/MIP3A transcript variant 2 expression plasmide de Gène l'ADNc ORF clone, C-OFPSpark MarqueurHG10485-ACRCHF270
Humain CCL20/MIP-3 alpha/MIP3A transcript variant 2 expression plasmide de Gène l'ADNc ORF clone, C-Flag MarqueurHG10485-CFCHF230
Humain CCL20/MIP-3 alpha/MIP3A transcript variant 2 expression plasmide de Gène l'ADNc ORF clone, C-His MarqueurHG10485-CHCHF230
Humain CCL20/MIP-3 alpha/MIP3A transcript variant 2 expression plasmide de Gène l'ADNc ORF clone, C-Myc MarqueurHG10485-CMCHF230
Humain CCL20/MIP-3 alpha/MIP3A transcript variant 2 expression plasmide de Gène l'ADNc ORF clone, C-HA MarqueurHG10485-CYCHF230
Humain CCL20/MIP-3 alpha/MIP3A transcript variant 2 Gène ADNc clone le vecteur de clonageHG10485-MCHF90
Humain CCL20/MIP-3 alpha/MIP3A transcript variant 2 expression plasmide de Gène l'ADNc ORF clone, N-Flag MarqueurHG10485-NFCHF230
Humain CCL20/MIP-3 alpha/MIP3A transcript variant 2 expression plasmide de Gène l'ADNc ORF clone, N-His MarqueurHG10485-NHCHF230
Humain CCL20/MIP-3 alpha/MIP3A transcript variant 2 expression plasmide de Gène l'ADNc ORF clone, N-Myc MarqueurHG10485-NMCHF230
Humain CCL20/MIP-3 alpha/MIP3A transcript variant 2 expression plasmide de Gène l'ADNc ORF clone, N-HA MarqueurHG10485-NYCHF230
Humain CCL20/MIP-3 alpha/MIP3A transcript variant 2 expression plasmide de Gène l'ADNc ORF cloneHG10485-UTCHF230
 En savoir plus sur les vecteurs d'expression
Product nameProduct name

Chemokine (C-C motif) ligand 20 (CCL20) or liver activation regulated chemokine (LARC) or Macrophage Inflammatory Protein-3 (MIP3A) is a small cytokine belonging to the CC chemokine family that attracts immature dendritic cells and memory T lymphocytes, both expressing CCR6. Depending on the cell type, this chemokine was found to be inducible by cytokines (IL-1beta) and by bacterial, viral, or plant products (including LPS, dsRNA, and PMA). MIP3A / CCL20 is Expressed predominantly in the liver, lymph nodes, appendix, peripheral blood lymphocytes, and fetal lung. Low levels of MIP3A / CCL20 has been seen in thymus, prostate, testis, small intestine and colon. As a chemotactic factor, MIP3A / CCL20 attracts lymphocytes and, slightly, neutrophils, but not monocytes. This chemokine may Inhibit proliferation of myeloid progenitors in colony formation assays and it may be involved in formation and function of the mucosal lymphoid tissues by attracting lymphocytes and dendritic cells towards epithelial cells. Its C-terminal processed forms have been shown to be equally chemotactically active for leukocytes. Chemokine CCL20 was shown to play a role in colorectal cancer (CRC) pathogenesis.

  • Vicinus B, et al. (2012) miR-21 functionally interacts with the 3'UTR of chemokine CCL20 and down-regulates CCL20 expression in miR-21 transfected colorectal cancer cells. Cancer Lett. 316(1): 105-12.
  • Ding X, et al. (2012) High Expression of CCL20 Is Associated with Poor Prognosis in Patients with Hepatocellular Carcinoma after Curative Resection. J Gastrointest Surg. 16(4): 828-36.
  • Ivison SM, et al. (2010) Oxidative stress enhances IL-8 and inhibits CCL20 production from intestinal epithelial cells in response to bacterial flagellin. Am J Physiol Gastrointest Liver Physiol. 299(3): 733-41.
  • Size / Price
    Catalogue : HG10485-CY
    Prix catalogue : 
    Prix :      (You Save: )
    Taille :
    Quantité :+-
    Disponibilité2-3 weeks
    Bulk Discount RequiryAjouter au panier
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.