Commande rapide

Humain CCL26/Eotaxin-3 expression plasmide de Gène l'ADNc ORF clone, C-Myc Marqueur

    Fiche techniqueCommentairesProduits apparentésProtocoles
    Humain CCL26 Informations sur les produits clonés de cDNA
    Gene_bank_ref_id:NM_006072.4
    Taille du ADNc:285bp
    Description du ADNc:Full length Clone DNA of Homo sapiens chemokine (C-C motif) ligand 26 with C terminal Myc tag.
    Synonyme du gène:IMAC, TSC-1, MIP-4a, SCYA26, MGC126714, MIP-4alpha
    Espèces:Human
    Vecteur:pCMV3-C-Myc
    Plasmid:
    Site de restriction:
    Séquence du marqueur:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
    Description de la séquence:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with CCL26 qPCR primers for gene expression analysis, HP100584 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Stockage:The lyophilized plasmid can be stored at room temperature for three months.
    Myc Tag Info

    A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

    A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

    The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

    Product nameProduct name
    Fond

    The eotaxin subfamily of CC chemokines consists of eotaxin-1/CCL11, eotaxin-2/CCL24 and eotaxin-3/CCL26. All eotaxins induce the trafficking of eosinophils to the sites of inflammation via CC chemokine receptor 3 (CCR3), which is also expressed by several different cell types, including basophils, dendritic cells, smooth muscle cells, epithelial cells and fibroblasts. The sequence similarity between the three eotaxins is limited (<40%), but their functional properties are very similar. Eotaxin-1 and -2 are expressed by both haematopoietic and non-haematopoietic cells, but eotaxin-3 expression has been reported to be limited to non-haematopoietic cells. Interleukin (IL)-4 is the main inducer for eotaxin-3 expression, whereas eotaxin-1 is up-regulated by IL-4 and the proinflammatory cytokine tumour necrosis factor (TNF)-α. Eotaxin-3 is expressed in vascular endothelial cells and human dermal fibroblasts after IL-4 and IL-13 stimulation, and this is dependent upon the IL-4-/IL-13-specific transcription factor, signal transducers and activator of transcription (STAT)-6. Eotaxin-3 is expressed on the surface of IL-4-stimulated endothelial cells and promotes eosinophil transmigration.

    Immune Checkpoint   Immunotherapy   Cancer Immunotherapy   Targeted Therapy

    Références
  • Takahashi K, Imaeda H, Fujimoto T, et al. Regulation of eotaxin-3/CC chemokine ligand 26 expression by T helper type 2 cytokines in human colonic myofibroblasts. Clinical and Experimental Immunology. 2013;173(2):323-331.
  • Size / Price
    Catalogue : HG10577-CM
    Prix catalogue : 
    Prix :      (You Save: )
    Taille :
    Quantité :+-
    Disponibilité
    Ajouter au panierBulk Discount Requiry

    Datasheet & Documentation

    Contact Us
      Articles consultés récemment
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Veuillez noter : Tous les produits sont « DESTINÉS À LA RECHERCHE UNIQUEMENT ET NE SONT PAS PRÉVUS POUR ÊTRE UTILISÉS À DES FINS DE DIAGNOSTIC OU THÉRAPEUTIQUES »