After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Commande rapide

Text Size:AAA

Humain CCL8/MCP-2 expression plasmide de Gène l'ADNc ORF clone, C-Flag Marqueur

Fiche techniqueCommentairesProduits apparentésProtocoles
Human CCL8 Informations sur les produits clonés de cDNA
Gene_bank_ref_id:NM_005623.2
Taille du ADNc:300bp
Description du ADNc:Full length Clone DNA of Homo sapiens chemokine (C-C motif) ligand 8 with C terminal Flag tag.
Synonyme du gène:HC14, MCP2, MCP-2, SCYA8, SCYA10
Espèces:Human
Vecteur:pCMV3-C-FLAG
Plasmid:
Site de restriction:
Séquence du marqueur:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Description de la séquence:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Product nameProduct name
Fond

Chemokines are a family of small chemotactic cytokines, or proteins secreted by cells. Chemokines share the same structure similarities such as small size, and the presence of four cysteine residues in conserved locations in order to form their 3-dimensional shape. Some of the chemokines are considered pro-inflammatory which can be induced to recruit cells of the immune system to a site of infection during an immune response, while others are considered homeostatic and are implied in controlling the migration of cells during normal processes of tissue maintenance and development. There are four members of the chemokine family: C-C kemokines, C kemokines, CXC kemokines and CX3C kemokines. The C-C kemokines have two cysteines nearby the amino terminus. There have been at least 27 distinct members of this subgroup reported for mammals, called C-C chemokine ligands-1 to 28. Chemokine ligand 8 (CCL8), also known as monocyte chemoattractant protein 2 (MCP-2), is a small cytokine belonging to the C-C chemokine family. CCL8 functions to activate different immune cells, including mast cells, eosinophils and basophils which are involved in allergic responses, monocytes, and T cells and NK cells which are involved in the inflammatory response. CCL8's ability achieves by binding to different cell surface receptors termed chemokine receptors including CCR1, CCR2B and CCR5. It has been reported that CCL8 is a potent inhibitor of HIV-1 by virtue of its binding to CCR5 which is one of the major co-receptors for HIV-1.

Références
  • Laing KJ, et al. (2004) Chemokines. Developmental and comparative immunology. 28 (5): 443-60.
  • Cocchi F, et al. (1995) Identification of RANTES, MIP-1a, and MIP-1b as the major HIV-suppressive factor produced by CD8+ T cells. Science. 270 (5243): 1811–5.
  • Hori T, et al. (2008) CCL8 is a potential molecular candidate for the diagnosis of graft-versus-host disease. Blood. 111 (8): 4403-12.
  • Biber K, et al. (2003) Expression of L-CCR in HEK 293 cells reveals functional responses to CCL2, CCL5, CCL7, and CCL8. Journal of Leukocyte Biology. 74 (2): 243-51.
  •  

    CCL8/MCP-2 related areas, pathways, and other information

    Size / Price
    Catalogue : HG10989-CF
    Prix catalogue : 
    Prix :      (You Save: )
    Taille :
    Quantité :+-
    Disponibilité2-3 weeks
    Bulk Discount RequiryAjouter au panier
    Contact Us
    Images
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Veuillez noter : Tous les produits sont « DESTINÉS À LA RECHERCHE UNIQUEMENT ET NE SONT PAS PRÉVUS POUR ÊTRE UTILISÉS À DES FINS DE DIAGNOSTIC OU THÉRAPEUTIQUES »