Cyclin A2 / CCNA2 cDNA ORF Clone, Human, N-DDK (Flag®) tag

1/1
Price:
Size:
Number:

Cyclin A2 / CCNA2 cDNA ORF Clone, Human, N-DDK (Flag®) tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1299 bp
Description
Full length Clone DNA of Human cyclin A2 with N terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

Cyclin A2 / CCNA2 cDNA ORF Clone, Human, N-DDK (Flag®) tag: Validated Images

The plasmid was transfected into 293H adherent cells with Sinofection reagent (Cat# STF02). After 48 h, Immunofluorescence staining of cells. Cells were fixed with 4% PFA, permeabilzed with 0.3% Triton X-100 in PBS, blocked with 10% serum, and incubated with Mouse anti-Flag Tag monoclonal antibody (CST#8146S) at 37℃ 1 hour. Then cells were stained with Goat Anti-mouse IgG secondary antibody. The fluorescent signal is detected by fluorescence microscope. Each expression experiment has negative control.

Cyclin A2 / CCNA2 cDNA ORF Clone, Human, N-DDK (Flag®) tag: Alternative Names

CCN1 cDNA ORF Clone, Human; CCNA cDNA ORF Clone, Human

Cyclin A2 / CCNA2 Background Information

CCNA2 (also known as CyclinA2) belongs to the highly conserved cyclin family and is significantly overexpressed in various cancer types. CCNA2 had significant predictive power in distant metastasis free survival, disease free survival, recurrence free survival and overall survival of ER+ breast cancer patients. We also found that CCNA2 was closely associated with tamoxifen resistance. CCNA2 is a biomarker for the prognosis of ER+ breast cancer and monitoring of tamoxifen efficacy. CCNA2 gene plays an important role in hair follicle initiation and development, and it is involved in the distinctive wool density of the Rex rabbit. It is an important candidate gene for wool density selection through marker-assisted selection.
Full Name
cyclin A2
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait