Commande rapide

Text Size:AAA

Humain Endoglin/CD105 transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, N-Myc Marqueur

Fiche techniqueCommentairesProduits apparentésProtocoles
Human ENG Informations sur les produits clonés de cDNA
Taille du ADNc:1977bp
Description du ADNc:Full length Clone DNA of Homo sapiens endoglin (ENG), transcript variant 1 with N terminal Myc tag.
Synonyme du gène:Eng, END, ORW, HHT1, ORW1, CD105, FLJ41744
Site de restriction:
Séquence du marqueur:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Description de la séquence:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Humain Endoglin/CD105 transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, N-Myc Marqueur on other vectors
Humain Endoglin/CD105 transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, C-GFPSpark MarqueurHG10149-ACGCHF290
Humain Endoglin/CD105 transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, C-OFPSpark MarqueurHG10149-ACRCHF290
Humain Endoglin/CD105 transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, C-Flag MarqueurHG10149-CFCHF260
Humain Endoglin/CD105 transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, C-His MarqueurHG10149-CHCHF260
Humain Endoglin/CD105 transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, C-Myc MarqueurHG10149-CMCHF260
Humain Endoglin/CD105 transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, C-HA MarqueurHG10149-CYCHF260
Humain Endoglin/CD105 transcript variant 1 Gène ADNc clone le vecteur de clonageHG10149-MCHF90
Humain Endoglin/CD105 transcript variant 1 expression plasmide de Gène l'ADNc ORF cloneHG10149-M-NCHF260
Humain Endoglin/CD105 transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, N-Flag MarqueurHG10149-NFCHF260
Humain Endoglin/CD105 transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, N-His MarqueurHG10149-NHCHF260
Humain Endoglin/CD105 transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, N-Myc MarqueurHG10149-NMCHF260
Humain Endoglin/CD105 transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, N-HA MarqueurHG10149-NYCHF260
Humain Endoglin/CD105 transcript variant 1 expression plasmide de Gène l'ADNc ORF cloneHG10149-UTCHF260
 En savoir plus sur les vecteurs d'expression
Product nameProduct name

Endoglin, also known as CD105, is a type I  homodimeric transmembrane glycoprotein with a large, disulfide-linked, extracellular region and a short, constitutively phosphorylated cytoplasmic tail. Endoglin contains an RGD tripeptide which is a key recognition structure in cellular adhesion,,suggesting a critical role for endoglin in the binding of endothelial cells to integrins and/or other RGD receptors. Endoglin is highly expressed on vascular endothelial cells, chondrocytes, and syncytiotrophoblasts of term placenta. It is also found on activated monocytes, mesenchymal stem cells and leukemic cells of lymphoid and myeloid lineages. As an accessory receptor for the TGF-β superfamily ligands, endoglin binds TGF-β1 and TGF-β3 with high affinity not by itself but by associating with TGF-β type I I receptor (TβRII) and activates the downstream signal pathways. In addition, in human umbilical vein endothelial cells, ALK-1 is also a receptor kinase for endoglin threonine phosphorylation, and mutations in either of the two genes result in the autosomal-dominant vascular dysplasia, hereditary hemorrhagic telangiectasia (HHT). Endoglin has been regarded as a powerful biomarker of neovascularization, and is associated with several solid tumor types.

Size / Price
Catalogue : HG10149-NM
Prix catalogue : 
Prix :      (You Save: )
Taille :
Quantité :+-
Disponibilité2-3 weeks
Bulk Discount RequiryAjouter au panier
Contact Us
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.