Commande rapide

Text Size:AAA

Humain VCAM1/VCAM-1/CD106 transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, N-His Marqueur

Fiche techniqueCommentairesProduits apparentésProtocoles
Human VCAM1 Informations sur les produits clonés de cDNA
Taille du ADNc:2220bp
Description du ADNc:Full length Clone DNA of Homo sapiens vascular cell adhesion molecule 1, transcript variant 1 with N terminal His tag.
Synonyme du gène:VCAM1, CD106, MGC99561, INCAM-100, DKFZp779G2333
Site de restriction:
Séquence du marqueur:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Description de la séquence:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Humain VCAM1/VCAM-1/CD106 transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, N-His Marqueur on other vectors
Humain VCAM1/VCAM-1/CD106 transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, C-GFPSpark MarqueurHG10113-ACGCHF290
Humain VCAM1/VCAM-1/CD106 transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, C-OFPSpark MarqueurHG10113-ACRCHF290
Humain VCAM1/VCAM-1/CD106 transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, C-Flag MarqueurHG10113-CFCHF260
Humain VCAM1/VCAM-1/CD106 transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, C-His MarqueurHG10113-CHCHF260
Humain VCAM1/VCAM-1/CD106 transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, C-Myc MarqueurHG10113-CMCHF260
Humain VCAM1/VCAM-1/CD106 transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, C-HA MarqueurHG10113-CYCHF260
Humain VCAM1/VCAM-1/CD106 transcript variant 1 Gène ADNc clone le vecteur de clonageHG10113-MCHF90
Humain VCAM1/VCAM-1/CD106 transcript variant 1 expression plasmide de Gène l'ADNc ORF cloneHG10113-M-NCHF260
Humain VCAM1/VCAM-1/CD106 transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, N-Flag MarqueurHG10113-NFCHF260
Humain VCAM1/VCAM-1/CD106 transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, N-His MarqueurHG10113-NHCHF260
Humain VCAM1/VCAM-1/CD106 transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, N-Myc MarqueurHG10113-NMCHF260
Humain VCAM1/VCAM-1/CD106 transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, N-HA MarqueurHG10113-NYCHF260
Humain VCAM1/VCAM-1/CD106 transcript variant 1 expression plasmide de Gène l'ADNc ORF cloneHG10113-UTCHF260
 En savoir plus sur les vecteurs d'expression
Product nameProduct name

Vascular cell adhesion molecule 1 (VCAM-1), also known as CD106, is a cell surface sialoglycoprotein belonging to the immunoglobulin superfamily. Two forms of VCAM-1 with either six or seven extracellular Ig-like domains are generated by alternative splicing, with the longer form predominant. VCAM-1 is an endothelial ligand for very late antigen-4 (VLA-4) and α4ß7 integrin expressed on leukocytes, and thus mediates leukocyte-endothelial cell adhesion and signal transduction. VCAM-1 expression is induced on endothelial cells during inflammatory bowel disease, atherosclerosis, allograft rejection, infection, and asthmatic responses. During these responses, VCAM-1 forms a scaffold for leukocyte migration. VCAM-1 also activates signals within endothelial cells resulting in the opening of an "endothelial cell gate" through which leukocytes migrate. VCAM-1 has been identified as a potential anti-inflammatory therapeutic target, the hypothesis being that reduced expression of VCAM-1 will slow the development of atherosclerosis. In addition, VCAM-1-activated signals in endothelial cells are regulated by cytokines indicating that it is important to consider both endothelial cell adhesion molecule expression and function during inflammatory processes.

  • Cook-Mills JM. (2002) VCAM-1 signals during lymphocyte migration: role of reactive oxygen species. Mol Immunol. 39(9): 499-508.
  • Preiss DJ, et al. (2007) Vascular cell adhesion molecule-1: a viable therapeutic target for atherosclerosis? Int J Clin Pract. 61(4): 697-701.
  • Size / Price
    Catalogue : HG10113-NH
    Prix catalogue : 
    Prix :      (You Save: )
    Taille :
    Quantité :+-
    Disponibilité2-3 weeks
    Bulk Discount RequiryAjouter au panier
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.