After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Commande rapide

Text Size:AAA

Humain FLT3/CD135/FLK-2 expression plasmide de Gène l'ADNc ORF clone, C-His Marqueur

Fiche techniqueCommentairesProduits apparentésProtocoles
Human FLT3 Informations sur les produits clonés de cDNA
Gene_bank_ref_id:NM_004119.2
Taille du ADNc:2982bp
Description du ADNc:Full length Clone DNA of Homo sapiens fms-related tyrosine kinase 3 with C terminal His tag.
Synonyme du gène:FLK2, STK1, CD135, FLT3
Espèces:Human
Vecteur:pCMV3-C-His
Plasmid:
Site de restriction:
Séquence du marqueur:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Description de la séquence:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Humain FLT3/CD135/FLK-2 expression plasmide de Gène l'ADNc ORF clone, C-His Marqueur on other vectors
Humain FLT3/CD135/FLK-2 expression plasmide de Gène l'ADNc ORF clone, C-GFPSpark MarqueurHG10445-ACGCHF390
Humain FLT3/CD135/FLK-2 expression plasmide de Gène l'ADNc ORF clone, C-OFPSpark MarqueurHG10445-ACRCHF390
Humain FLT3/CD135/FLK-2 expression plasmide de Gène l'ADNc ORF clone, C-Flag MarqueurHG10445-CFCHF354
Humain FLT3/CD135/FLK-2 expression plasmide de Gène l'ADNc ORF clone, C-His MarqueurHG10445-CHCHF354
Humain FLT3/CD135/FLK-2 expression plasmide de Gène l'ADNc ORF clone, C-Myc MarqueurHG10445-CMCHF354
Humain FLT3/CD135/FLK-2 expression plasmide de Gène l'ADNc ORF clone, C-HA MarqueurHG10445-CYCHF354
Humain FLT3/CD135/FLK-2 Gène ADNc clone le vecteur de clonageHG10445-MCHF90
Humain FLT3/CD135/FLK-2 expression plasmide de Gène l'ADNc ORF clone, C-Flag MarqueurHG10445-M-FCHF354
Humain FLT3/CD135/FLK-2 expression plasmide de Gène l'ADNc ORF clone, C-His MarqueurHG10445-M-HCHF354
Humain FLT3/CD135/FLK-2 expression plasmide de Gène l'ADNc ORF cloneHG10445-M-NCHF354
Humain FLT3/CD135/FLK-2 expression plasmide de Gène l'ADNc ORF clone, N-Flag MarqueurHG10445-NFCHF354
Humain FLT3/CD135/FLK-2 expression plasmide de Gène l'ADNc ORF clone, N-His MarqueurHG10445-NHCHF354
Humain FLT3/CD135/FLK-2 expression plasmide de Gène l'ADNc ORF clone, N-Myc MarqueurHG10445-NMCHF354
Humain FLT3/CD135/FLK-2 expression plasmide de Gène l'ADNc ORF clone, N-HA MarqueurHG10445-NYCHF354
Humain FLT3/CD135/FLK-2 expression plasmide de Gène l'ADNc ORF cloneHG10445-UTCHF354
 En savoir plus sur les vecteurs d'expression
Product nameProduct name
Fond

The cluster of differentiation (CD) system is commonly used as cell markers in immunophynotyping. Different kinds of cells in the immune system can be identified through the surface CD molecules which associating with the immune function of the cell. There are more than 320 CD unique clusters and subclusters have been identified. Some of the CD molecules serve as receptors or ligands important to the cell through initiating a signal cascade which then alter the behavior of the cell. Some CD proteins do not take part in cell signal process but have other functions such as cell adhesion. CD135, also known as FLT-3, FLK-2, is a member of the CD system. CD135 is an important cell surface marker recognized by specific sets of antibodies to identify the types of hematopoietic (blood) progenitors in the bone marrow and it function to differentiate hematopoietic stem cells, which are CD135 negative, from multipotent progenitors, which are CD135 positive. CD135 is a receptor tyrosine kinase typeⅢ for the cytokine Flt3 ligand and activat signaling through second messengers by binding to Flt3. Signaling through CD135 is important for lymphocyte development. The encoding gene CD135 is a proto-oncogene to which mutations happened will lead to cancer such as leukemia.

Références
  • Zola H, et al. (2007) CD molecules 2006-human cell differentiation molecules. J Immunol Methods. 318 (1-2): 1-5.
  • Ho IC, et al. (2009) GATA3 and the T-cell lineage: essential functions before and after T-helper-2-cell differentiation. Nat Rev Immunol. 9 (2): 125-35.
  • Matesanz-Isabel J, et al. (2011) New B-cell CD molecules. Immunology Letters.134 (2): 104-12.
  • Bertho, et al. (2000) CD135 (Flk2 / Flt3) Expression by Human Thymocytes Delineates a Possible Role of FLT3-Ligand in T-Cell Precursor Proliferation and Differentiation. Scandinavian Journal of Immunology. 52 (1): 53-61.
  • Size / Price
    Catalogue : HG10445-CH
    Prix catalogue : 
    Prix :      (You Save: )
    Taille :
    Quantité :+-
    Disponibilité2-3 weeks
    Bulk Discount RequiryAjouter au panier
    Contact Us
    Images
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Veuillez noter : Tous les produits sont « DESTINÉS À LA RECHERCHE UNIQUEMENT ET NE SONT PAS PRÉVUS POUR ÊTRE UTILISÉS À DES FINS DE DIAGNOSTIC OU THÉRAPEUTIQUES »