FLT3 cDNA ORF Clone, Human, N-His tag

1/1
Price:
Size:
Number:

FLT3 cDNA ORF Clone, Human, N-His tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
2997 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence except for the point mutations: 303C/T not causing the amino acid variation.
Description
Full length Clone DNA of Human fms-related tyrosine kinase 3 with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Restriction Sites
KpnI + XbaI(6kb+3kb)
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

FLT3 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

FLT3 cDNA ORF Clone, Human, N-His tag: Validated Images

FLT3 cDNA ORF Clone, Human, N-His tag: Alternative Names

CD135 cDNA ORF Clone, Human; FLK-2 cDNA ORF Clone, Human; FLK2 cDNA ORF Clone, Human; STK1 cDNA ORF Clone, Human

FLT3 Background Information

The cluster of differentiation (CD) system is commonly used as cell markers in immunophynotyping. Different kinds of cells in the immune system can be identified through the surface CD molecules which associating with the immune function of the cell. There are more than 32 CD unique clusters and subclusters have been identified. Some of the CD molecules serve as receptors or ligands important to the cell through initiating a signal cascade which then alter the behavior of the cell. Some CD proteins do not take part in cell signal process but have other functions such as cell adhesion. CD135, also known as FLT-3, FLK-2, is a member of the CD system. CD135 is an important cell surface marker recognized by specific sets of antibodies to identify the types of hematopoietic (blood) progenitors in the bone marrow and it function to differentiate hematopoietic stem cells, which are CD135 negative, from multipotent progenitors, which are CD135 positive. CD135 is a receptor tyrosine kinase typeⅢ for the cytokine Flt3 ligand and activat signaling through second messengers by binding to Flt3. Signaling through CD135 is important for lymphocyte development. The encoding gene CD135 is a proto-oncogene to which mutations happened will lead to cancer such as leukemia.
Full Name
fms-related tyrosine kinase 3
References
  • Zola H, et al. (2007) CD molecules 2006-human cell differentiation molecules. J Immunol Methods. 318 (1-2): 1-5.
  • Ho IC, et al. (2009) GATA3 and the T-cell lineage: essential functions before and after T-helper-2-cell differentiation. Nat Rev Immunol. 9 (2): 125-35.
  • Matesanz-Isabel J, et al. (2011) New B-cell CD molecules. Immunology Letters.134 (2): 104-12.
  • Bertho, et al. (2000) CD135 (Flk2 / Flt3) Expression by Human Thymocytes Delineates a Possible Role of FLT3-Ligand in T-Cell Precursor Proliferation and Differentiation. Scandinavian Journal of Immunology. 52 (1): 53-61.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait